Transcript

gcm2-202

ID
ZDB-TSCRIPT-090929-9742
Name
gcm2-202
Previous Names
  • gcm2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027170 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027170|OTTDARG00000021381|ZDB-GENE-050127-1 gcm2|OTTDARP00000022261 gcm2-002 LG_ BX546453.8 Danio rerio protein_coding KNOWN, 2031 bp
GAGACATGTAAGAAAAATCTATATAACAAAAACTACTGCT
TCAGCCATCAAGTCAAAGCTTTTTGGTTTTGTTGCGAAGG
GACTCGTTCGTTATTGGCGGTGAAACGCACGGATTACGTA
AAGTGAAAGAAGTATTTGAGGTTGTGTGTGCGTGTGTAAG
CCCAGCCTTCTTCTTTACATAGACACAGCAGTATTTACCT
GAGACCATTACCTGTGTGAAGCGCACCTGTACGGACTCGC
ATAACGTGGATTTTACAAGAGAGAAAAAAAGACTCTGGAA
GTAAAGCTCCCAAGGACGTGAGATATCAGTTTGACAGCTC
AGACTGCGTGTGTTCATTCGGGATGAAGTTGACTTGGGAT
ATAAACGACCCCAAGCTTCCACAGGACACGAAGCAGTATG
ATGCTTTTCAGGAGTGGACAGATGGTTATGTGCGTTACAT
CTACAGTAGTGAAGATAAGAATGCGCAAAGACACCTGAGC
GGATGGGCCATGAGAAACACGAACAACCATAACTGTCAGA
TCCTGAAAAAGTCTTGTCTTGGTGTGGTGGTGTGCTCACG
AAACTGCTCTCTTCCAGACGGATCCAAACTTCAGCTGAGA
CCAGCCATCTGTGACAAAGCGCGACAGAAACAGCAGAAAA
AGCTTTGTCCGAACTGTAACTCAGCTCTTGAATTGATTCC
GTGCCGAGGTCACAGTGGTTATCCTGTTACGAACTTTTGG
AGAGTAGATGGGAAGGCTATATTTTTCCAGGCTAAAGGAG
TACATGACCATCCCAGACCAGAGAGCAAGTCTGAAACAGA
GGCAAGAAGGAGTGCGGTAAAAAGAAGGATGTCTTCACCA
CCCTTTTCGCAGAAGAGAAGACTGGTGGAGCCAGAGCCTG
GACGATATCATGACATGGCCTTTCCAAATATCCACCAGCT
CACCATGGAGGGTCCAGAGCGATTCAGCATCATTGCAGAG
TCCAACTTCCCAATACAGACCCAACACTATCCCACATTTC
AGAACCCTGAGCCCTACAAATTCCCATACGACACACATGC
AGCAGCAATGGCGGATGCTCAGAGCTCACTACAGAAGCCT
GCTAACCACCGTCTGTATGTGACTCGTCCTCCCTGTGGTT
ATGACTTTGCAGTCCCAGGATACCTTGGCTCAGGGCCTTA
TCCAGCAGCATTGTATAAGGATCCTTCTAGCCCACAAATG
GAGACAGAACCCAATAAGTCAGGGTCTAGCCTAAGTGGAG
TGTCTCATGGCTCAAGTCCATTAGGCAGTCATGAACGGAG
CTATGCTGAATCTTCGGGAAAACATCACGGATGGAAGCAA
ATTCTTAGTAAAGGTGGCTATGGGGACAGAGGAGACTACT
CTCAACTGCCGACTAACGCCAACCACCACTACTACAATAG
TGACTACCCATGTAGGTACACGGGGCCTGCTGCTCCAACC
CCTGCAGCGTTGCAGACCATAATAACCACAACCACAAAAG
TTTCCTACCAGCCATGTCCAAAGCCGTCTGTCGTCAAGTA
CGGAGAGAACATTTATGACGTGAAAGGTCTGTCTAACTGT
AACTCAATCTTAGAAGAGCCCTCTCCCAACTCCTACTCGG
ACCTGAAGATTCCTGAGGATTCGGGAGTAATCAAATCTGC
TCTGTCATACCAGGACACACTTCCAGCTAAAATTGAGCGG
TCTGAAAACTTTGAGGGTTATCGATACAGCAGTTACAGCG
CAAACAGTTACCCTGAAAGAATGTCACATCCTTTCAGATA
TGACAGCGGGGAATACTGAGGGACTGGAAAACAGAAGGAA
AAAAATCTCAGCAAGTATATACCAATGTGCTATTTATGTT
CAGTATTTGAGCTCTTTAAATGTTTTAGTTTTAAAGGAAT
AAAAAATTTTAAATATTTTTGTGTAAACTTTTGATCCACG
ATGATTAAATATGCTGACATCAGTGTTGAGAACATTTCCA
TTGAATGTGTTTGAGATCTGTGATTCGTTATTGTCCTTGA
AAGAAATAAAGAACATGTGTCAAAAAAAGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations