Transcript

gcm2-201

ID
ZDB-TSCRIPT-090929-9741
Name
gcm2-201
Previous Names
  • gcm2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027169 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027169|OTTDARG00000021381|ZDB-GENE-050127-1 gcm2|OTTDARP00000022260 gcm2-001 LG_ BX546453.8 Danio rerio protein_coding KNOWN, 2099 bp
ATCAAGTCAAAGCTTTTTGGTTTTGTTGCGAAGGGACTCG
TTCGTTATTGGCGGTGAAACGCACGGATTACGTAAAGTGA
AAGAAGTATTTGAGGTTGTGTGTGCGTGTGTAAGCCCAGC
CTTCTTCTTTACATAGACACAGCAGTATTTACCTGAGACC
ATTACCTGTGTGAAGCGCACCTGTACGGACTCGCATAACG
TGGATTTTACAAGAGAGAAAAAAAGACTCTGGAAGTAAAG
CTCCCAAGGACGTGAGATGTACGATCCATTTAGTAAATTG
ATCTAGATACCGAGCTGAATTTTGCCTTGAAACTGATTTT
TTAAATGGTTGTTATCATCCGGAGTTGACTCAAATCATGT
CCAAATCCTCAGATCAGTTTGACAGCTCAGACTGCGTGTG
TTCATTCGGGATGAAGTTGACTTGGGATATAAACGACCCC
AAGCTTCCACAGGACACGAAGCAGTATGATGCTTTTCAGG
AGTGGACAGATGGTTATGTGCGTTACATCTACAGTAGTGA
AGATAAGAATGCGCAAAGACACCTGAGCGGATGGGCCATG
AGAAACACGAACAACCATAACTGTCAGATCCTGAAAAAGT
CTTGTCTTGGTGTGGTGGTGTGCTCACGAAACTGCTCTCT
TCCAGACGGATCCAAACTTCAGCTGAGACCAGCCATCTGT
GACAAAGCGCGACAGAAACAGCAGAAAAAGCTTTGTCCGA
ACTGTAACTCAGCTCTTGAATTGATTCCGTGCCGAGGTCA
CAGTGGTTATCCTGTTACGAACTTTTGGAGAGTAGATGGG
AAGGCTATATTTTTCCAGGCTAAAGGAGTACATGACCATC
CCAGACCAGAGAGCAAGTCTGAAACAGAGGCAAGAAGGAG
TGCGGTAAAAAGAAGGATGTCTTCACCACCCTTTTCGCAG
AAGAGAAGACTGGTGGAGCCAGAGCCTGGACGATATCATG
ACATGGCCTTTCCAAATATCCACCAGCTCACCATGGAGGG
TCCAGAGCGATTCAGCATCATTGCAGAGTCCAACTTCCCA
ATACAGACCCAACACTATCCCACATTTCAGAACCCTGAGC
CCTACAAATTCCCATACGACACACATGCAGCAGCAATGGC
GGATGCTCAGAGCTCACTACAGAAGCCTGCTAACCACCGT
CTGTATGTGACTCGTCCTCCCTGTGGTTATGACTTTGCAG
TCCCAGGATACCTTGGCTCAGGGCCTTATCCAGCAGCATT
GTATAAGGATCCTTCTAGCCCACAAATGGAGACAGAACCC
AATAAGTCAGGGTCTAGCCTAAGTGGAGTGTCTCATGGCT
CAAGTCCATTAGGCAGTCATGAACGGAGCTATGCTGAATC
TTCGGGAAAACATCACGGATGGAAGCAAATTCTTAGTAAA
GGTGGCTATGGGGACAGAGGAGACTACTCTCAACTGCCGA
CTAACGCCAACCACCACTACTACAATAGTGACTACCCATG
TAGGTACACGGGGCCTGCTGCTCCAACCCCTGCAGCGTTG
CAGACCATAATAACCACAACCACAAAAGTTTCCTACCAGC
CATGTCCAAAGCCGTCTGTCGTCAAGTACGGAGAGAACAT
TTATGACGTGAAAGGTCTGTCTAACTGTAACTCAATCTTA
GAAGAGCCCTCTCCCAACTCCTACTCGGACCTGAAGATTC
CTGAGGATTCGGGAGTAATCAAATCTGCTCTGTCATACCA
GGACACACTTCCAGCTAAAATTGAGCGGTCTGAAAACTTT
GAGGGTTATCGATACAGCAGTTACAGCGCAAACAGTTACC
CTGAAAGAATGTCACATCCTTTCAGATATGACAGCGGGGA
ATACTGAGGGACTGGAAAACAGAAGGAAAAAAATCTCAGC
AAGTATATACCAATGTGCTATTTATGTTCAGTATTTGAGC
TCTTTAAATGTTTTAGTTTTAAAGGAATAAAAAATTTTAA
ATATTTTTGTGTAAACTTTTGATCCACGATGATTAAATAT
GCTGACATCAGTGTTGAGAACATTTCCATTGAATGTGTTT
GAGATCTGTGATTCGTTATTGTCCTTGAAAGAAATAAAGA
ACATGTGTCAAAAAAAGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations