Transcript

abcd3a-002

ID
ZDB-TSCRIPT-090929-9708
Name
abcd3a-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027128 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027128|OTTDARG00000021359|ZDB-GENE-040426-2868 abcd3a|no_translation abcd3a-002 LG_ BX682238.10 Danio rerio protein_coding KNOWN, 460 bp
GGCGGCCGTCAGCAAGTACTTGACAGCGAAGAACTCCGCG
GTGGCTGGCGGTGTCCTACTCGTTTTATACATCCTAAAGC
AGAGACGAAGAGCCGCAGCACTAAACAGGAAGAAGGGGTC
TGCAAATGAATTGAACAGTGAGAAAGATGGCAAGAAAGAA
AGGGCCGCTGTGGACAAGTTATTTTTCATCCGGATCTCAC
GGATCCTCAAGATTATGGTTCCGAAATTCTTCAGCAAAGA
GACATGGTATCTGCTCCTGATCGCAGTGATGCTTGTGACT
CGGACGTATTGTGATGTCTGGATGATTCAGAACGGCACAA
TGATTGAAAGATCGCCCTGGTGAATAACTTCCTGAAGTTG
GGCCTGAATGAACTGAAATTGTGCTTTCGTGTGAGGCTTA
CCAAACATCTCTACGATGAATACCTAAAGGGATATACGTA
CTACAAAATGGGAAACCTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations