Transcript

abcd3a-201

ID
ZDB-TSCRIPT-090929-9707
Name
abcd3a-201
Previous Names
  • abcd3a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027127 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027127|OTTDARG00000021359|ZDB-GENE-040426-2868 abcd3a|OTTDARP00000022232 abcd3a-001 LG_ BX682238.10 Danio rerio protein_coding KNOWN, 2802 bp
AAAGGGTTAATAAACAGAGCGGGTCCATGATGATGGTGCG
ATGATGATGTCACGAGTACGGTAGCCGGTAGAGGGACGGA
TTCTTCCATTCTGTCTCTCTTTTCTGGGATTGTGTGCGCT
GTGCGTACACACACACACACCGCCGCTGTTCTCCGGGCCG
TCAGTAGGAAACATGGCGGCCGTCAGCAAGTACTTGACAG
CGAAGAACTCCGCGGTGGCTGGCGGTGTCCTACTCGTTTT
ATACATCCTAAAGCAGAGACGAAGAGCCGCAGCACTAAAC
AGGAAGAAGGGGTCTGCAAATGAATTGAACAGTGAGAAAG
ATGGCAAGAAAGAAAGGGCCGCTGTGGACAAGTTATTTTT
CATCCGGATCTCACGGATCCTCAAGATTATGGTTCCGAAA
TTCTTCAGCAAAGAGACATGGTATCTGCTCCTGATCGCAG
TGATGCTTGTGACTCGGACGTATTGTGATGTCTGGATGAT
TCAGAACGGCACAATGATTGAAAGTGCAATCATTGGTCGA
TCCACTAAAGGTTTCAAGAAGTACTTATTCAACTTTATGA
CGGCCATGCCAATTATCGCCCTGGTGAATAACTTCCTGAA
GTTGGGCCTGAATGAACTGAAATTGTGCTTTCGTGTGAGG
CTTACCAAACATCTCTACGATGAATACCTAAAGGGATATA
CGTACTACAAAATGGGAAACCTGGATAACCGCATTGCTAA
TGCTGATCAGCTTCTGACGCAGGATGTTGAAAGGTTCTGT
AACAGCGTTGTTGATCTGTACTCCAACCTCAGCAAACCCT
TGTTGGATATCGGTTTGTACATATTCAAATTGACAACAGC
AATTGGCGCTCAAGGTCCCGCGACCATGATGGCCTACCTG
CTGATCTCCGGCCTCTTCCTGACCCGCCTGCGCAGGCCGA
TCGGCAAGATGACTGTGACAGAACAGAAGTATGAAGGAGA
ATACAGATATGTCAACTCCCGTCTCATCACAAACAGTGAA
GAGATTGCCTTCTATAATGGAAACACCAGGGAGAAACAGA
CAATTCATTCAACCTTCAAAAAACTGGTGGATCATCTGCA
CAATTTCATCTTCTTTCGTTTCTCCATGGGTATGGTGGAC
AGCATTATCGCCAAGTATTTTGCTACCGTTGTCGGGTATC
TAGTCGTTAGTCGTCCTTTCCTAAATTTGTCTCACTCTCG
ACATCTGAACAGCTCACATGCTGAACTGCTGGAGGACTAC
TATCAGAGCGGCCGTATGTTGTTGCGGATGTCGCAGGCAT
TGGGCAGAATCGTGCTTGCAGGCAGAGAAATGACGCGTCT
ATCAGGCTTCACAGCTCGCATCACTGAGCTCATGAGAGTC
CTGAAAGAGCTGAACTCTGGTAAATACGAACGCACCATGG
TGTCCCAGTCAGAGAAAGATGCTTCAGAAAAGCTCACACT
GGTGCCTGGAAGTGGAAGAATCATCAACATAGACAATATC
ATCAAGTTCGATCACACACCTCTGGCTACTCCTAATGGAG
ATGTTCTGATCAGAGATCTGTGTTTTGAGGTGAAATCTGG
AACCAATGTTTTGGTGTGTGGTCCGAACGGATGCGGAAAA
AGTTCACTTTTTCGCGTTCTTGGAGAGTTGTGGCCACTGT
TTGGTGGGAATCTGACGAAACCAGAGAGAGGGAAGCTCTT
CTACGTCCCTCAGAGGCCTTACATGACTCTCGGTTCGCTG
AGGGATCAAGTGATCTATCCAGACACCCATGAGAGTCAAA
AGAAGAAAGGCATCTCTGACCTGGTGCTAAAGGAGTATCT
GGATAATGTCCAGTTAGGACACATTTTGGACAGAGAGGGT
TCATGGGATACAGTTCAGGACTGGATGGATGTGCTCAGTG
GAGGAGAGAAGCAGAGAATGGCGATGGCCAGACTCTTCTA
CCATAAGCCCCAGTTTGCCATCCTGGATGAATGTACCAGT
GCCGTGAGCGTAGACGTGGAGGATTACATCTACAGTCACT
GCAGAAAGGTTGGCATCACCCTGTTCACAGTCTCTCACAG
AAAGTCCCTGTGGAAGCATCATGAGTACTACCTCCATATG
GACGGCAGAGGAAACTACGAATTCAAACCCATCACACCGG
AAACTGTGGAGTTCGGCTCTTAAAGAGGAGCGACAGCACT
ATCAGAGGCCCTAGTTAGGTGCCCTAACCGTTCACTTCCT
AAAGAGTCGCTTGCCAAGCTAATCTAGGAGTTTGTTTTTA
ATCATCTGTAACCTTTATTTTTGGGATGAAATCGTGTTTA
GGAATTTATTAACACTACTTTCGTTCTCTCTGATTGTATA
TAATTTTGTAAATTAAGCAGTCCAATTTATAGGACGTCCG
TTAAGTACGCCAAAACAGCGTATTGTCGTGTCTTGTCAAT
GCACTTAATTGTTTAATAAATGAAATTTTGTCCGTATAGG
CTCACGCAAACCAACACCACAAGACTGAACTACATGTTAA
TGAATTATTATTGCCTTTTTTCATCAGCTAAACCTTACAT
CATGAATTCTTTTAAGCTACTAAGTGGCCTTAGTGCTCAT
TGCAGCATCGTTGGGCGGTTTGAACGTGTGCAAGTTGCTC
TTTTTAGTGCACTTTAGCGTGGATGGAGATCTGAAAAGCT
GAAAGACTCTATCTGTATTCGATGAGAAGTCGCCTATGCA
CTTGTTTACTGCAGAATTTTCGATGTGAATGTCAGAAACG
TCATTGTCGTAGCATTTCACACATGAAGCAAACAAAACCA
CTTTGCTGTACGTTTTCATTAAAAAAGGAGATATTGGTAC
TA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations