Transcript

her9-002

ID
ZDB-TSCRIPT-090929-9630
Name
her9-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027042 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027042|OTTDARG00000021294|ZDB-GENE-011213-1 her9|no_translation her9-002 LG_ CR751236.6 Danio rerio protein_coding KNOWN, 854 bp
TCGACTTGCCCTCTGAAGCGCTGCGCCACACACACGCTCG
TGTCCTCATATGACAGCCTCCCGACTATAAGTCATAAAGC
TGATAAGAGGGACTCACACTCTCTCTCGTGATCGTCCCGA
GATCTTGGCTACGTTCCGCATCTAATCCTAAGAGCCCGTT
CCTGTTGTTTTTTTTTAAACCACACACGGAATATATTCAC
TTTTTGGCTTCTACCGGACTCAACTTTGGTGTTTGATCAT
GCCAGCCGATAATATGGAGAAGCAGACAGCATCACCTATT
GCTGGTGCCCCTGCCAGTGGATCTCATACTCCTGACAAGC
CAAAGAATGCCAGCGAGCATAGAAAGTCTTCAAAGCCAAT
CATGGAAAAGCGCCGCAGAGCGAGAATCAACGAGAGCCTT
GGGCAGCTGAAGACTCTCATTCTTGATGCTCTTAAAAAAG
ATGTAAGTTTTATCTACAACTCTTGTCATGCTTCAGTCAC
CCGACGTTAGTAATTCTGAAACAGTTTCTAACCGAATTCT
GCTCATTCACAGAGCTCCAGACACTCTAAATTGGAGAAAG
CTGATATTCTGGAGATGACAGTCAAGCACCTGCGCAATTT
ACAACGTGTTCAGATGAGCGCAGCCTTGTCAGCTGACACA
AACGTCCTCAGCAAGTACCGCGCAGGATTCAACGAGTGCA
TGAACGAGGTGACTCGATTTCTCTCTACCTGCGAGGGAGT
GAATACAGAGGTCAGATCGCGACTTCTTAACCACCTGTCC
GGTTGTATGGGACAGATGATGGCCATGAACTACCCTCAGC
CTGCCCCCGCTCAACAGGCTCATTTGGCTCAGCCTCTTCA
CGTGCAGCTTCCTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations