Transcript

her9-201

ID
ZDB-TSCRIPT-090929-9629
Name
her9-201
Previous Names
  • her9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027041 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027041|OTTDARG00000021294|ZDB-GENE-011213-1 her9|OTTDARP00000022163 her9-001 LG_ CR751236.6 Danio rerio protein_coding KNOWN, 1461 bp
ATCTATAAATACCGCTGGCGTGTGGCAGTGGGAGATTCGA
CTTGCCCTCTGAAGCGCTGCGCCACACACACGCTCGTGTC
CTCATATGACAGCCTCCCGACTATAAGTCATAAAGCTGAT
AAGAGGGACTCACACTCTCTCTCGTGATCGTCCCGAGATC
TTGGCTACGTTCCGCATCTAATCCTAAGAGCCCGTTCCTG
TTGTTTTTTTTTAAACCACACACGGAATATATTCACTTTT
TGGCTTCTACCGGACTCAACTTTGGTGTTTGATCATGCCA
GCCGATAATATGGAGAAGCAGACAGCATCACCTATTGCTG
GTGCCCCTGCCAGTGGATCTCATACTCCTGACAAGCCAAA
GAATGCCAGCGAGCATAGAAAGTCTTCAAAGCCAATCATG
GAAAAGCGCCGCAGAGCGAGAATCAACGAGAGCCTTGGGC
AGCTGAAGACTCTCATTCTTGATGCTCTTAAAAAAGATAG
CTCCAGACACTCTAAATTGGAGAAAGCTGATATTCTGGAG
ATGACAGTCAAGCACCTGCGCAATTTACAACGTGTTCAGA
TGAGCGCAGCCTTGTCAGCTGACACAAACGTCCTCAGCAA
GTACCGCGCAGGATTCAACGAGTGCATGAACGAGGTGACT
CGATTTCTCTCTACCTGCGAGGGAGTGAATACAGAGGTCA
GATCGCGACTTCTTAACCACCTGTCCGGTTGTATGGGACA
GATGATGGCCATGAACTACCCTCAGCCTGCCCCCGCTCAA
CAGGCTCATTTGGCTCAGCCTCTTCACGTGCAGCTTCCTT
CAACGTTACCCATCAACGGCGCCTCAATGGGTTCCAAACT
CAGTCCTTCAGAAGCGGTCTCACCAAAAGTCTTTGGAGGA
TTCCAGCTGGTGCCAGCCACGGACGGACAGTTTGCTTTTC
TTATCCCCAACCCAGCGTTTGCTTCTGCTACAACTCCAGT
CATTCCCTTGTACGCAAACGCAAGCGTTCCAGTAACTGTC
AACGCCAGTCCCGTCCAGGCCAGCTCGGCTCCCACGGTCG
CATCTCCTGTCCAGGGAATGACCTCCTTCTCGGGCGTTCC
ACAAGCCGTCAGTCCCGTTGGTGTCAGTGCCGGAGCAGAA
AGCAATGAGCCGGTGTGGAGACCCTGGTAGACTTGCGCAT
CTCATATGAACTTATAAAGTTTTCATGGTGAAGAATATAC
GTTCAGTTCCGTTCTAAGGGACTTTGTTGACCTTTTGTTG
GGCAAGTGTTTGTTAGCTGATTCCAATATTTGGATGTTGT
TAATGAATGTGCTGTTGTGAATACAACAGAATAACACTTA
ATGTTTATAAAGTACTTTTTTAAATCAAAGAGTTTAGTTT
TGTACAAAGTTTGTAAAAGACTGTATCATGCCAAAGCTTC
CTTGTTCTTTTCATGATGAGTGTTTATGTTTGATGCTGAA
TAAATCAAAATAACGAAATTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations