ZFIN ID: ZDB-TSCRIPT-090929-9581
Transcript Name: pmelb-201
Previous Names: pmelb-001, silvb-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026991 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026991|OTTDARG00000021269|ZDB-GENE-050912-2 pmelb|OTTDARP00000022122 silvb-001 LG_ BX465853.12 Danio rerio protein_coding KNOWN, 2196 bp
CTGAAAGTCTTTAAAGTGCCAACAAAGTGACACAATGAAG
CTATTCTCTACAATATTCATATTATCCAGTTTGTCCGGGG
GATTAACAAGACAAGCTGACCGAAGCAACTCCAATTCCCG
ATTCAATCAGTATCAGACACTGAATACAAAGCGGTTCCCA
GTTTGGAATGATGGAGACCCACGCTACAAAACCAGCTGGA
TGGGTGGCCAGCTGAAGTTTGATGTGGGAAATGATGCTCC
TACCTTGACCGGTGCAAAAATCAGCTTCACCATTGACATC
GTGTTCCCTCATAACCAGAAGGTCCTGCCTGATGGACAAG
TTGTTTGGGCAAAAAACTGCACCATCAATGGCACACAGTT
TCACGAAGGCGAGCCCGTGTATCCTGAGGAAAACTCATGG
AACGCTGTGTCTCCAAATGCTCATCTCTTTTCCAGACAGG
GAGACAAGCCACCTCCATATGTGTTTGTATGGAAAACCTG
GGGCAAATACTGGCAGGTTTGCGACGGTCCTTCCTCTTCG
CTGACCATCGACACTGATGATGTTCCTCTGGGCTCTTATA
TAATGGATGTTGTCATCTATCACTACAGGCAAAAAGACAG
ATTCATCCCCATTGGATTTGCATCCACACAGTTCTCGATC
ATTGACCAGATTCCCTTTGCGGTTTCTCTGACTCAGGTAA
ACGACAAAGACCAAGGTGATCACAAATTCGTCCAGAACAG
AGCAGTGGCCTTCAGCATCACCCTTCACGACCCCAGTGAG
TACTTGAGCAAATCTGACGTGACTTTCAACTGGAACTTCG
GGGATGGCAGTGGCACTGTAATATCCAGGGAATCCACCGT
CACACACACTTACATTGCATCTGGGGTCTTCAAGCCGCAA
GTCGTCGTACAGGCAGCTATTCCAGATCCGTCTTGTTCAG
GTCCACCGAATCCTCCAGTTGAAGGATCCACTGCCAACAC
CTTCACCTCTGAGAGCCCCAAACACCCCAGCGAACACCTC
GCTACAGATCATCCTACCAGACATTTTTCAGCACCCTTTG
TGAAATCCACACCTGTATCTGCAATGAAAACTGTTCCACC
TGCACCTACAAATGGAGATCCATCAAAATCCAGCCTTGAG
AGGCAGGTTGTTGATCTTGTACCTGAATTTAAGATGTCTG
AAACACTGAATACTGTGACAAACACACCACTGAAGGCAAC
TGCCACAGACATGGTGATGGTGGAGGATGAGTCTATTGAA
AACCAAGCCCATGTGTCGATAATAAAGCGTCAGGCCCCAA
ACATAAACGGCTGTGTGATTTACCGATATGGATCCTTCTC
AACTGATATCGAGATTATCGAGGGCATTGAGAGTGTGCAG
ATCGTCCAGGTGGCTGTAGCTGATGGCTTTCTGCTAACAG
AGATGGAGCAGAATGCTGTGGATTTCACCGTTTCTTGCCA
AGGAAGCATCCCCACTGAAGTGTGCACTATAGTGTCGGAT
GCTGACTGTCATGCACCAGTTATGACCATCTGCAATGCCG
TGAGCCCATCTTCAGATTGCCAACTCATCCTTCGTCATTT
CTTCAATGACTCTGGAACCTTCTGCATTAATGTGTCCATG
GCGAATGACGTCAGTATGGCTGTCACAAATGCCAGGGTTA
ACATAAACATAGCAGGTTCCAGGTTGACATCTGCAGGTGC
CGCGGCCCTGTTGTTGGGGATCTTGACTGTCGTATCAGCA
ATGGCTGCTGTAGCTTTTGCGTATAAGCGTCTTAAAGGGT
ACCAAAGGCTGACTGAGGATCCAGTAGCATGCCAATCCAA
TGATTCCGGCGTGTGCTCAATGCCAGCGCTTTTCTGGAGC
CTGATGAACCACCAGACGGTGGATCAGAAAAAAGGAGTAG
TGTGAATTTTACTTTCGATGATGAAAAAATGTAGGTAGCA
TTGGCACTATTTTGAATAGCATTAAGAAATTTGAACCTTT
TGTACCACTTTTCAATCTTTAATGTTTGAATTGGATTTTG
TATTATTTTTGTACACACATTTGACCCCAAATTGTTTTTT
TTTCTACCAAAAACTGTTAGTAAGTACAGCGTTCATACTT
TAAACTTGAATTTAGAAAGGAAACTTTGGGCCAACAAAGC
TTATTTGGTAAAGGACTTCTGGAACCCCATGCATTCATTT
TTAACACTACTGAATAAAATATCACAAAAGCTGCTA

pmelb TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pmelb-201 2196
pmelb-202 (1)    Ensembl 811
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pmelb-201 Contained in:
[BAC] DKEY-18F23 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000026991 (1),  Ensembl_Trans:ENSDART00000046268 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC116462 (1) 2219 nt
GenBank:AY864065 (1) 1851 nt
GenBank:CN500732 (1) 794 nt
CITATIONS (2)