header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9582
Transcript Name: pmelb-202
Previous Names: pmelb-002, silvb-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026992 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026992|OTTDARG00000021269|ZDB-GENE-050912-2 pmelb|OTTDARP00000022123 silvb-002 LG_ BX465853.12 Danio rerio protein_coding KNOWN, 811 bp
GAGTCTATTGAAAACCAAGCCCATGTGTCGATAATAAAGC
GTCAGGCCCCAAACATAAACGGCTGTGTGATTTACCGATA
TGGATCCTTCTCAACTGATATCGAGATTATCGAGGGCATT
GAGAGTGTGCAGATCGTCCAGGTGGCTGTAGCTGATGGCT
TTCTGCTAACAGAGATGGAGCAGAATGCTGTGGATTTCAC
CGTTTCTTGCCAAGGAAGCATCCCCACTGAAGTGTGCACT
ATAGTGTCGGATGCTGACTGTCATGCACCAGTTATGACCA
TCTGCAATGCCGTGAGCCCATCTTCAGATTGCCAACTCAT
CCTTCGTCATTTCTTCAATGACTCTGGAACCTTCTGCATT
AATGTGTCCATGGCGAATGACGTCAGTATGGCTGTCACAA
ATGCCAGGGTTAACATAAACATAGGTTCCAGGTTGACATC
TGCAGGTGCCGCGGCCCTGTTGTTGGGGATCTTGACTGTC
GTATCAGCAATGGCTGCTGTAGCTTTTGCGTATAAGCGTC
TTAAAGGGTACCAAAGGCTGACTGAGGATCCAGTAGCATG
CCAATCCAATGATTCCGGCGTGTGCTCAATGCCAGCGCTT
TTCTGGAGCCTGATGAACCACCAGACGGTGGATCAGAAAA
AAGGAGTAGTGTGAATTTTACTTTCGATGATGAAAAAATG
TAGGTAGCATTGGCACTATTTTGAATAGCATTAAGAAATT
TGAACCTTTTGTACCACTTTTCAATCTTTAATGTTTGAAT
TGGATTTTGTATTATTTTTGTACACACATTTGACCCCAAA
TTGTTTTTTTT

pmelb TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA pmelb-201 (1) 2196
pmelb-202 811
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pmelb-202 Contained in:
[BAC] DKEY-18F23 (1) (order this)

OTHER pmelb-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026992 (1)
  • Ensembl_Trans:ENSDART00000132320 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK689269 (1) 813 bp
    CITATIONS (2)