Transcript

hm13-201

ID
ZDB-TSCRIPT-090929-9255
Name
hm13-201
Previous Names
  • hm13-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026621 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026621|OTTDARG00000021067|ZDB-GENE-020802-3 hm13|OTTDARP00000021837 hm13-001 LG_ BX323461.27 Danio rerio protein_coding KNOWN, 1953 bp
ACCCGCCAGAAGAAGAGGAAGAACACTCACCGGGCTGATT
TTAGGAAACGTGGCCTTAACAGCGATCGGTTCCCCCTCAA
TGAGCAGCGCACTCAGTGACACTCTAATTAAACCGCTTGT
ATCTAACGTTAAGCCTATCCCGGTAACCGAGCGCGCTGAA
ACATGGCGGATGTGGAGCAGACCGCGCCGGCGCCCGACGG
CTCAAGTAATGGGTCGGATTTGGTAAACGGGACTGCGGGC
CGGTTCGTGTCCAGCGCTGAGGGTACGGCTCTGGCGTACG
GCAGCCTGCTGCTCATGGCCCTGCTGCCCATCTTCTTCGG
GGCGCTCAGGTCTGTGGGATGCTCCAAATCCAAGGGATCT
TCTGATATGCCCGAGACCATCACCAGCAGAGATGCAGCTC
GATTCCCCATCATCGCCAGCTGCACACTCTTCGGCCTCTA
CCTCTTTTTCAAGGTTTTCTCACAGGAGTATGTCAACATG
CTGTTATCCATGTATTTCTTTGTGCTGGGAATATTAGCGC
TGTCTCACACAATGAGTCCCTTCATGTGCAGAGTTTTCCC
TGCTAACCTGTCAAATAAGCAGTACCAGCTGCTGTTCACA
CAGGGCTCAGGAGAAAGCAAAGAGGAAATAGTCAACTATG
AGTTTGACACGAAGGATCTGATCTGCCTGTGCATCAGCAG
TGTGGTAGGGGTCTGGTACGTCCTCAAGAAGCACTGGATA
GCCAATAACCTGTTTGGTCTGGCGTTTGCTCTGAACGGCG
TGGAGCTGCTGCACCTCAATAACGTCAGCACCGGATGCAT
TCTGCTGGGAGGACTCTTCGTTTACGACGTCTTCTGGGTT
TTTGGCACTAATGTTATGGTGACAGTTGCCAAGTCCTTTG
AAGCCCCGATCAAGTTGGTTTTCCCTCAAGATTTGCTGGA
GAAAGGTTTGGGCGCCAGTAACTTTGCCATGCTGGGACTC
GGGGACATTGTTATTCCAGGAATTTTTATTGCTCTGCTCC
TGCGCTTTGATGTCAGTCTGAAGAAGAACACACGAACATA
CTTCTACACCAGCTTCCTGGCTTACATTTTTGGCCTGGGT
CTGACCATTTTCGTGATGCACACCTTTAAACATGCTCAGC
CTGCTTTGCTGTACCTGGTGCCTGCTTGTGTTGGATTTCC
AGTGCTGGTGGCACTTGTTAAAGGAGAACTAACCGAGATG
TTCAGGTACGAGGAGGAAACGCCATCAAAAGAAGAGACGA
CCGAATCTGAAAAAGACAAATAAAAGCCCCAAATCAGCCC
TCATTCATGTTTTGCATTTGTCATAGTGATGTGGTCGCGC
ACAGACTCCTCTCCGTCTGCTCATGGCGGTGACGTTGTGT
ATTTCTGAACTTCTTTTAACGCCGCGCAACAGCTTTCTCA
GTGCCTCTGTAATGAAATCCCCCTGTTCCTTTATTCACCT
CAGCATTTGGAAACATTGGTTATATTCACTTCCAAAGTTA
TATCTGTTAGAATTATGAAGTATTTGGTTGGTAGACGTAA
GACTTTCCGCATGTGATTCGATATTCAGATATCATCCGAA
TCTAAGGTCCGGCACCTACTCCATGTACTCCTATTTTGTT
TGTTTTTATTGTAGGATCTCATGAGGGATTCGGTTTCTAG
CTGTCTGTTTTATTTAATAAGACAAAGGCATTCTGGATTA
CATGTGTTGTTTTATTTTATGCAAACTGTGGGACCAATAA
GAAAGAGACTGTTTGTTTTTCTCCCCCTGACGGAAGTTAA
AGGATGAACTTGAGTAGTGCCATATTGTTTCTTGCTCATA
TTTAATGCACCTCATGCTCGCCATGGTTTGACCGTCTCTT
CTTGTGTAACGCTTTTCTCAGTGTAAATGTTTGAGCTTAT
ATGAGGAGCACTGTTTTGATTTTGTCTTTTATTTGCATTA
AATGTGTGGTGTTTACCAATCTGGAAAAACACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations