Transcript

hm13-002

ID
ZDB-TSCRIPT-090929-9256
Name
hm13-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026622 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026622|OTTDARG00000021067|ZDB-GENE-020802-3 hm13|no_translation hm13-002 LG_ BX323461.27 Danio rerio protein_coding KNOWN, 749 bp
TTCTGAAGCTCTTTTAAAAACCTTGAAAACACTGGATTAA
ATATCAAGAACTTCATTTTCATGCCAATAGTGTTTTAGTT
TTGACAGAAGTGTTTGTGCGTTTGCTGACAGCACTGGATA
GCCAATAACCTGTTTGGTCTGGCGTTTGCTCTGAACGGCG
TGGAGCTGCTGCACCTCAATAACGTCAGCACCGGATGCAT
TCTGCTGGGAGGACTCTTCGTTTACGACGTCTTCTGGGTT
TTTGGCACTAATGTTATGGTGACAGTTGCCAAGTCCTTTG
AAGCCCCGATCAAGTTGGTTTTCCCTCAAGATTTGCTGGA
GAAAGGTTTGGGCGCCAGTAACTTTGCCATGCTGGGACTC
GGGGACATTGTTATTCCAGGAATTTTTATTGCTCTGCTCC
TGCGCTTTGATGTCAGTCTGAAGAAGAACACACGAACATA
CTTCTACACCAGCTTCCTGGCTTACATTTTTGGCCTGGGT
CTGACCATTTTCGTGATGCACACCTTTAAACATGCTCAGC
CTGCTTTGCTGTACCTGGTGCCTGCTTGTGTTGGATTTCC
AGTGCTGGTGGCACTTGTTAAAGGAGAACTAACCGAGATG
TTCAGGTACGAGGAGGAAACGCCATCAAAAGAAGAGACGA
CCGAATCTGAAAAAGACAAATAAAAGCCCCAAATCAGCCC
TCATTCATGTTTTGCATTTGTCATAGTGATGTGGTCGCGC
ACAGACTCCTCTCCGTCTGCTCATGGCGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations