header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9249
Transcript Name: fbxo32-201
Previous Name: fbxo32-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026615 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026615|OTTDARG00000021063|ZDB-GENE-040426-1040 fbxo32|OTTDARP00000021834 fbxo32-001 LG_ BX571853.4 Danio rerio protein_coding KNOWN, 1752 bp
GAGACGCGTTCAGACACAGTGGGATTTAATATTGCGGCGA
GAAAAGCACTTAAACCGCTTCTCAAGTTTAACATTAGTTG
GTTTTCTTTCGTTGTCGCTCGTTTTCGGTTCTTGACAATG
CCGTTTCTTGGACAAGACTGGCGGTCTCCTGGTCAAAGCT
GGGTTAAAACAGAGGACGGCTGGAAAAAAACGACGAAAGA
TGACAACGAGACGAATAACAATGTTTTGGAGAGGAAGAGC
TACTGCAAGGAAGAGCATGACAAAGAGAATTTGATCCTCA
GCATTAATTATGATGTGGCTGCAAAGAAGCGAAAGAAGGA
CTTGCTGAACAACAACACAAAAATTCCATATTTTTATAAA
GACAAATGGATTTATGTCCATAAAGGGAGCACCAAAGAGC
GTCATGGATATTGTACTCTGGGAGAAGCATTCAATCGCTT
GGACTTCTGCAGTGCCATCAAGGACACCAGGCGATTTAAT
TATGTCGTAAGGCTGCTGGAGCTCATCGCCAAGTCCCAAC
TGCCTTCTCTGAGTGGAGTGGCACAGAAAAACTACATGAA
CATTCTGGAAAGGGTTGTGCAGAAAGTTCTCGATGATCAG
CAAAATGTCCGGCCGATTAAAGAACTTCTGCAGACACTGT
ATGCGTCTCTGTGCAGTCTGGTTCAGGACATGGGCAAGTC
TGTGCTGGTGGGCAACATCAACATCTGGGTGCATCGCATG
GAGAACATACTGCAGTGGCAGCAGCAGCTAGACAACATTC
AGATCAACAGGCCCAAAAACACAGGGATGACGTTGCTGGA
ACTGCCAGTGAGTTTACAGCTCAACATCATGCAGCGTCTC
TCGGATGGACGAGATCTGGTCAGTCTGGGTCAAGTGTGTC
CTGACCTGAGTATGTTGACAGAAGATCGGCTGCTGTGGAA
AAAGCTCTGCCAGTATCACTTCACAGACAGACAGATCCGC
AAGCGCCTCATGGTTTCAGATAAAGGGCAGTTGGAATGGA
AAAAGATGTATTTTAAGCTGTGTCGGTGTTACCCTCACAA
AGAGCAGTACAGCGACACATTACAGTTCTGCACACACTGC
CACATCCTCTTCTGGAAGGATACAGACCATCCTTGCACTG
CCAATAACCCAGAGAGCTGTTGCAAAGCAGTGTCTCCACA
GGGTTTCATCAACCTCTTCAAGTTTTAGCAGCGCTGCATT
GCTGCCATGATGTACATAGTGTCAATAGTGCAAAGATTCC
TGGATGACTTGAGGCAGGGAGAAGACGACTTGCATTAAAA
GCAGATGCCTGTGTTACGTGGAGGAGTTTGGAAACTGAAT
GTACTCAAATATGCACGACGAAAAACCAAAAAGCTGCGTT
GGGGAAAACATGCTCTGTTTATTTAAAAAGATTGTTTTAT
TTATTTATTTAGCATGGATCTTGTTTACTCTAAATTGAAG
ATTTGGAAAAAAGGAGTAATATGTGCATACAACAAAAAAT
GCTGCCCTGGTCTCTTCTGTGAATGTAAAATAGGTTCGAT
ATTTGTCAGCGCGAGCGATTTTTCTTTGTTTGAACTTCAG
ATAGCATATTGGTGCTTCAGCAAGTGCATGATATGGGAAT
GTTTACCAAAATGGCCTTAATACTGGTGTGCAATACTTTT
CTAAGGAAGTCTCCTGTTTTTGTTTTTCACTTTTTTATAC
ATTTGATATTTTCAGTGGTTTGCGATTTAAACATGCTTGG
GGTTTTTTTTTTAAACACAATAAAAACAGAAG

fbxo32 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA fbxo32-002 (1) 607
mRNA fbxo32-201 1752
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fbxo32-201 Contained in:

OTHER fbxo32-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026615 (1)
  • Ensembl_Trans:ENSDART00000058938 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC052112 (1) 1804bp
    CITATIONS (2)