ZFIN ID: ZDB-TSCRIPT-090929-9250
Transcript Name: fbxo32-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026616 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026616|OTTDARG00000021063|ZDB-GENE-040426-1040 fbxo32|no_translation fbxo32-002 LG_ BX571853.4 Danio rerio protein_coding KNOWN, 607 bp
GTAATGCTGGAACACACAGTCTCTCAGTCTGACCTCTCAA
ATTTATGTTTAACATTTCAGCTGCTGGAGCTCATCGCCAA
GTCCCAACTGCCTTCTCTGAGTGGAGTGGCACAGAAAAAC
TACATGAACATTCTGGAAAGGGTTGTGCAGAAAGTTCTCG
ATGATCAGCAAAATGTCCGGCCGATTAAAGAACTTCTGCA
GACACTGTATGCGTCTCTGTGCAGTCTGGTTCAGGACATG
GGCAAGTCTGTGCTGGTGGGCAACATCAACATCTGGGTGC
ATCGCATGGAGAACATACTGCAGTGGCAGCAGCAGCTAGA
CAACATTCAGATCAACAGGCCCAAAAACACAGGGATGACG
TTGCTGGAACTGCCAGTGAGTTTACAGCTCAACATCATGC
AGCGTCTCTCGGATGGACGAGATCTGGTCAGTCTGGGTCA
AGTGTGTCCTGACCTGAGTATGTTGACAGAAGATCGGCTG
CTGTGGAAAAAGCTCTGCCAGTATCACTTCACAGACAGAC
AGATCCGCAAGCGCCTCATGGTTTCAGATAAAGGGCAGTT
GGAATGGAAAAAGATGTATTTTAAGCTGTGTCGGTGTTAC
CCTCACA

fbxo32 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA fbxo32-001 (1) 1752
ncRNA fbxo32-002 607
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fbxo32-002 Contained in:
OTHER fbxo32-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026616 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB898345 (1) 607bp
    CITATIONS (1)