header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9244
Transcript Name: apoeb-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026610 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026610|OTTDARG00000021059|ZDB-GENE-980526-368 apoeb|no_translation apoeb-003 LG_ BX004983.8 Danio rerio protein_coding KNOWN, 882 bp
AAGACCTGCCATCCAAACTGCTCCACACGGAGAAAAATCA
CGCTTCTCAGGTGTTCTTGTCTGTCCATCAACATGAGGTC
TCTTGTGGTATTCTTTGCTCTGGCAGTTTTAACTGTCTCT
TCTCACCTCTTGTAGGCTGCCAGGCTCGTAGCCTGTTCCA
GGCTGATGCCCCTCAGCCCAGATGGGAGGAGATGGTGGAC
CGTTTCTGGCAGTATGTGTCTGAACTCAACACACAAACTG
ACGGCATGGTGCAAAACATCAAGGGCTCCCAGCTCAGCAG
AGAGCTTGACACACTAATTACTGACACCATGGCTGAACTG
AGCTCATACAGTGAAAATCTCCAAACCCAGATGACCCCAT
ACGCCTCTGATGCTGCTGGTCAGCTCAGTAAAGATCTTCA
GCTCCTGGCTGGAAAACTCCAAACTGACATGACCGACGCT
AAGGAACGCAGCACTCAGTACCTGCAAGAGCTGAAGACCA
TGATGGAGCAGAATGCAGATGACGTGAAGAACCGTGTCGG
CACCTACACACGCAAACTGAAGAAACGCCTGAACAAGGAC
ACAGAGGAGATCCGCAACACCGTAGCAACCTACATGAGTG
AGATGCAGTCCCGCGCTTCCCAAAATGCTGATGCAGTGAA
GGACCGTTTCCAGCCATACATGAGCCAGGCCCAGGATGGC
GCCACCCAGAAACTGGGCGCCATTAGCGAGCTGATGAAGG
CCCAGGCGCAGGAGGTGAGCGAGCAGTTGGAGGTCCAGGC
TGGAGCTCTGAAGGAGAAGCTGGAGGAGACAGCCGAGAAC
CTACGCACCTCTCTGGAGGGCCGTGTGGATGAGCTGACCA
GCCTCCTCGCCCCCTACTCCCAGAAGATCCGCGAGCAGCT
GC

apoeb TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA apoeb-003 882
apoeb-004 (1) 897
mRNA apoeb-201 (1) 1521
apoeb-204 (1) 846
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
apoeb-003 Contained in:
[BAC] DKEY-7F3 (1) (order this)
OTHER apoeb-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026610 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK864989 (1) 901bp
    GenBank:DV587733 (1) 785bp
    CITATIONS (1)