header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9243
Transcript Name: apoeb-204
Previous Name: apoeb-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026609 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026609|OTTDARG00000021059|ZDB-GENE-980526-368 apoeb|OTTDARP00000021830 apoeb-002 LG_ BX004983.8 Danio rerio protein_coding KNOWN, 846 bp
CGCTCTTTACTCGTGGACTCATCATCCTCTTATTACAGAA
GGGTTTATGGAGAAGAAAACTAGCTTAACTGTAAAAAATA
TTGCGTACTACACTTACAGTTAGCTTAATATTTATGCAAT
GTTTTAACGCGTTATGGATCGGTGTCGTCGTATCTCAGAT
GATGTTTTGAAGATGATTTGTATACGTTTAAAATCGTGTG
TTCTTGTCTGTCCATCAACATGAGGTCTCTTGTGGTATTC
TTTGCTCTGGCAGTTTTAACTGGCTGCCAGGCTCGTAGCC
TGTTCCAGGCTGATGCCCCTCAGCCCAGATGGGAGGAGAT
GGTGGACCGTTTCTGGCAGTATGTGTCTGAACTCAACACA
CAAACTGACGGCATGGTGCAAAACATCAAGGGCTCCCAGC
TCAGCAGAGAGCTTGACACACTAATTACTGACACCATGGC
TGAACTGAGCTCATACAGTGAAAATCTCCAAACCCAGATG
ACCCCATACGCCTCTGATGCTGCTGGTCAGCTCAGTAAAG
ATCTTCAGCTCCTGGCTGGAAAACTCCAAACTGACATGAC
CGACGCTAAGGAACGCAGCACTCAGTACCTGCAAGAGCTG
AAGACCATGATGGAGCAGAATGCAGATGACGTGAAGAACC
GTGTCGGCACCTACACACGCAAACTGAAGAAACGCCTGAA
CAAGGACACAGAGGAGATCCGCAACACCGTAGCAACCTAC
ATGAGTGAGATGCAGTCCCGCGCTTCCCAAAATGCTGATG
CAGTGAAGGACCGTTTCCAGCCATACATGAGCCAGGCCCA
GGATGGCGCCACCCAGAAACTGGGCGCCATTAGCGAGCTG
ATGAAG

apoeb TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA apoeb-003 (1) 882
apoeb-004 (1) 897
mRNA apoeb-201 (1) 1521
apoeb-204 846
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
apoeb-204 Contained in:
[BAC] DKEY-7F3 (1) (order this)
OTHER apoeb-204 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026609 (1)
  • Ensembl_Trans:ENSDART00000146077 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DV596856 (1) 789bp
    GenBank:DV590725 (1) 732bp
    CITATIONS (2)