ZFIN ID: ZDB-TSCRIPT-090929-9126
Transcript Name: slit3-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026452 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026452|OTTDARG00000020959|ZDB-GENE-010306-4 slit3|no_translation slit3-002 LG_none BX323583.36,AL928691.7 Danio rerio protein_coding KNOWN, 1244 bp
ACTATCAATGAGGATTTGCATGCTGGACCCAAAAAAAGCG
GAATTGGTGAAGAATGAGAAGGAACCACTTTGGACAGTTT
GAATGATTCTGGAGGCTTTTATGGACTCTTTTCTCTTAGC
AGCGATGCGTGTTTCTAACTTTTGATGCGCATTTACAGTG
GTGTGGACAAACATATGCAACTTCACGTTTGAATGGACAA
AGCTTTTTACCGATGAAGTTTTTTAAAACTGGAACTACTT
TATGCCGCTGTCGTAGTTCATCGTTAAGTTTTCCCAACTT
GTCCTACCTGTAGTGTTATTTCGCGCGCGGAACTTTATTG
GCTGTGAACAAGACACGGAGACTTTTTTGTTAGCCTTTGG
AATTTTTGTTTTATAAATAGTCCGCAACACTTTTGTTTTA
TAGCATTTTGAATATTTCTAGTATCGTTATTGGGCTGCTA
TCAGCCTCAGAGGATATATGATGCGGTGGGTAAAGTATTG
GGGGACAGTGGCTGTGCTCTGCGGGCTGCTGAGCTGTGCT
GTGAATGGATGCCCGCATAAGTGCAGTTGTTCGGGCTCTC
ATGTGGATTGTCAGGGTCAAGCCTTCAAGACGGTGCCTAG
GGGAATCCCGAGGAATGCCGAGAGACTGGATCTGGACAGG
AATAACATCACCCGGATCACCAAAGTGGACTTCTCTGGCC
TCAAGAACCTGCGCGTGCTACATCTAGAGAACAATCAAAT
AAGTGTGATTGAAAGAGGAGCATTTGAGGGTCTCAAACAA
CTTGAGAGAATCCGCCTGAACCGGAACCGGCTTCAGGTCC
TGCCGGAGCTGCTGTTCCAATCCACAACCAAGCTGAGCCG
CCTGGACCTGAGCGAGAATCAGATTCAGGCTGTTCCTCGT
AAGGCTTTCCGAGGGATCACCACTGTCAAGAACCTGCAAC
TGGACAGCAACCACATCAGCTGCATCGAAGATGGAGCCTT
CCGAGCCCTGCGCGATTTGGAGATACTGTGAGTCCCCCTC
CCGCCTCCTCTGCGGGGTTCTTTCCTCTCTTCTCACCTCT
GCTGTCCCTTCCTCTAACTCTAACTCTGTGTGTCTGTGTG
TTTCCTGATTGTTCCTGAAGGACAAACTGTGTTGCGTTGT
GGACCTGTGGCACATAGTCTGGTGTCACCCTGTCCTGCGC
TTAGCATGCGATCGTCCGTGCGACAGCTAAAGTTGCTCGT
TTGTCATCCTGTGCTGCATTGTTGCCGCTCTAAAAAAAAA
GAAA

slit3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA slit3-202 (1)    Ensembl 6146
ncRNA slit3-002 1244
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slit3-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000026452 (1),  Ensembl_Trans:ENSDART00000126199 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC093131 (1) 1248 bp
CITATIONS (2)