header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9125
Transcript Name: slit3-202
Previous Name: slit3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026451 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026451|OTTDARG00000020959|ZDB-GENE-010306-4 slit3|OTTDARP00000021695 slit3-001 LG_none BX323583.36,AL928691.7 Danio rerio protein_coding KNOWN, 6146 bp
CAAAAAAAGCGGAATTGGTGAAGAATGAGAAGGAACCACT
TTGGACAGTTTGAATGATTCTGGAGGCTTTTATGGACTCT
TTTCTCTTAGCAGCGATGCGTGTTTCTAACTTTTGATGCG
CATTTACAGTGGTGTGGACAAACATATGCAACTTCACGTT
TGAATGGACAAAGCTTTTTACCGATGAAGTTTTTTAAAAC
TGGAACTACTTTATGCCGCTGTCGTAGTTCATCGTTAAGT
TTTCCCAACTTGTCCTACCTGTAGTGTTATTTCGCGCGCG
GAACTTTATTGGCTGTGAACAAGACACGGAGACTTTTTTG
TTAGCCTTTGGAATTTTTGTTTTATAAATAGTCCGCAACA
CTTTTGTTTTATAGCATTTTGAATATTTCTAGTATCGTTA
TTGGGCTGCTATCAGCCTCAGAGGATATATGATGCGGTGG
GTAAAGTATTGGGGGACAGTGGCTGTGCTCTGCGGGCTGC
TGAGCTGTGCTGTGAATGGATGCCCGCATAAGTGCAGTTG
TTCGGGCTCTCATGTGGATTGTCAGGGTCAAGCCTTCAAG
ACGGTGCCTAGGGGAATCCCGAGGAATGCCGAGAGACTGG
ATCTGGACAGGAATAACATCACCCGGATCACCAAAGTGGA
CTTCTCTGGCCTCAAGAACCTGCGCGTGCTACATCTAGAG
AACAATCAAATAAGTGTGATTGAAAGAGGAGCATTTGAGG
GTCTCAAACAACTTGAGAGAATCCGCCTGAACCGGAACCG
GCTTCAGGTCCTGCCGGAGCTGCTGTTCCAATCCACAACC
AAGCTGAGCCGCCTGGACCTGAGCGAGAATCAGATTCAGG
CTGTTCCTCGTAAGGCTTTCCGAGGGATCACCACTGTCAA
GAACCTGCAACTGGACAGCAACCACATCAGCTGCATCGAA
GATGGAGCCTTCCGAGCCCTGCGCGATTTGGAGATACTCA
CTCTCAACAACAACAATATCACCCTCATCCCACTGTCAAG
CTTCAACCACATGCCAAAGCTGCGGACACTTCGCCTGCAC
TCCAACAACCTGCACTGCGACTGCCACCTGTCCTGGCTCT
CTGATTGGCTGCGGCAGAGGAGGGGTTTGGCCCCTTTCAC
ACAGTGCATGGCCCCCGCCCATATGAGAGGTCTCAATGTC
CCTGATGTTCAAAAGAGAGAATTTGTTTGCACAGGTCCCG
TAGAGACGGAGCCAAGGTCATGTGCTCCGCAGGTGACCAT
CTGCCCTGCCGCCTGCACCTGCAACAACAACATTGTGGAC
TGCCGTAGAAAAGGCCTGACTGAGATTCCTGCCAACCTGC
CTGAAGGAATCGTGGAAATCCGTCTGGAGCAGAACATGAT
CAAGAACATCCCAGCAGGAGCCTTCTCCACATACAAGAAA
CTCAAGAGAATAGACCTGAGCAAGAATCAGATATCCGAAA
TTGCAGAAGACGCATTTAGTGGCCTGCGCTCTCTCACGTC
ACTGGTCCTGTACGGAAATAAAATCGCAGAGATCCCAAAG
GGACTGTTTGATGGCCTGGTCTCCCTGCAACTGCTACTGC
TGAACGCCAACAAGATCAACTGCCTTCGAGTGAACACTTT
CAAAGATCTGCAGAACCTCAACCTGCTGTCCCTCTATGAC
AACAAACTTCAGACCATCAGCAAAGGCTTGTTCGCTCCTC
TGCGTGCCATCAAAACCCTACACCTCGCTCAGAATCCGTT
CATGTGTGACTGTCATCTGAAGTGGCTGGCCGACTACCTG
TTTGACAATCCAATTGAGACCAGCGGGGCTCGATGCAGCC
ACCCGCGCCGCCTCGCCAACAAGCGCATCAGCCAGGTCAA
GGGCAAGAAGTTTCGCTGCACAGGTGCGGAGGACTACCGC
AGTCGTCTCAGCGGCGAGTGTTTCCAAGACCTGGTTTGTC
CCGAACGCTGCCGATGTGAAGGAACAGTAGTGGACTGCTC
CAACCTCAAACTCACCAAAATCCCCCCTCACCTTCCTGAG
CACACCACTGACCTACGGCTGAACGACAATGAAATCTCCA
TCTTAGAGGCTACAGGAGCATTCAAGAAGCTTCCAAATCT
GCGCAAGATAAACTTGAGCAATAATAAACTCCGGGACATC
CGTGAGGGTGCGTTTGATGGGGCCGGAGGTGTTTTGGAGC
TGCTGTTGACTGGAAACAAGCTGCAGTCGGTCAGCGGACG
GATGTTCAAGGGTTTGATCGGCCTCAAAACACTGATGCTG
AGGAGTAATCAGATCAGCTGTGTGGATAACGCCACCTTCA
CCGGCTTGAGCTCTGTGCGCCTGCTTTCCCTCTACGATAA
CCGGATCTCCACTATCGCCCCCGGAGCTTTCAACACCCTG
CATTCCCTTTCCACCATTAACCTGCTGTCTAATCCCTACG
TGTGTGACTGTCACTTAGCCTGGCTGGGGCTGTGGCTTAA
GAAGACCAGGGTGGTTAGCGGAAACCCACGCTGTCAGAAA
CCTGCCTTCCTGAAGGAGATCCCTATTCAAGATGTGGCCA
TGCCTGATTTCTCCTGTGATGGTGCGGAAGAGAATGTGTG
CCTGCCGTCAGCCCCTCGATGTCCAGAATCCTGCACATGC
TCGGAAACCGTGGTGCGCTGTAGTAACCGTGGGCTGCGTT
CTCTGCCTAAGACTATCCCTAAAGATACAACTGAACTATA
CTTGGAAGGAAACCTCCTCACATCCGTTCCCAAAGAGCTT
CCTAATCTGAAACAACTGACACTCCTAGACCTTAGTAATA
ACAGCATCAGTCATCTTGCCCCTCTCACCTTCAGCAACAT
GACACAGCTCGCCACCCTTATCCTGAGCTATAATCAAATA
CGCTGCGTCCCGGTTCATGCGTTTGATGGCTTGCGCTCTC
TCCGCCTGCTAACTCTCCACGGAAATGACCTTTCAACTGT
TCCGGAGGGAGCCTTCAACCACTTGACATCTCTATCTCAT
CTAGCTCTCGGTGCGAACCCTTTATACTGTGACTGTGAGC
TGCGCTGGTTGTCTCAGTGGGTGAAGGCTGGCTTTAAAGA
GCCTGGCATCGCCCGCTGCACTGGACCACCCGACATGGCT
GACCGACTGCTGCTTACCACCCCCCTCAATCGCTTCCAGT
GCAAAGGTCCAGCAGATCTGAATCTGATGTCCAAGTGCGC
CCCCTGTCTGGCAACTCCCTGTCAGAATAATGGCACTTGT
GTGAGTGATGTCACAGGCTCCTACCACTGCACCTGCCCTT
TTGGCTACAAGGGTCGTAACTGTGAGATTCCTATTAACGC
CTGTATCAGCCTGCCATGTACCAATGGAGGCACGTGTCAC
CTCACACCTGGACTGGATGGACAGTACAGCTGCGTGTGTC
CTCCTGGGTATGAGGGCCAGCAGTGTGAACTGAATCCCGA
TGACTGTGAAGACAACGATTGTGAGAATAACTCCACCTGT
GTGGATGGCATCAACAACTACACTTGTGTCTGCCCCCCTA
ACTACAAAGGTGATCTGTGCGAGGAGGTGGTTGACCCCTG
TCTGCCTGGGTTTGACCTCTGCCAACACGACTCCAAGTGT
GTTCCTCTCAGCAAGGGCTACAGATGTGAGTGTTTGCCTG
GTTATGTTGGCCAGCAGTGTGAGCAGGATTACAATGACTG
TCTGGAGAACAAATGTCAGCATGGGGCAGAGTGTGTTGAC
GCCATCAATGGATACACATGTGTGTGCAAGGAGGGCTTCA
GTGGGCTATTCTGTGAGAATCATCCACCAATGGTATTGCT
CCAGAACACAAGTCCATGCGATCAGTCGGATTGTCAAAAT
GGATCCGAATGTCTGGTCATGGAAGGAGAGCCAGTGTGCC
GTTGTCTGCCTGGTTACTTCGGCACTAAGTGTCAAAAAAT
GGTCACACTGCACTTTCTCGGCAAGGAAGCTTACGTGGAG
CTCTCCGGCACCAGGATCCGACCACCCATGCACATTTCCT
TCCAGGTAGCCACTGATAAGGATAATGGCATTCTGTTGTA
TAAAGAGGACCATGACCCACTCGCCCTAGAACTGTACCAG
GGACACATCCGTTTGATCTATGACATTTCCAAATACCCCC
CAACCACTGTGTACAGTGTGGAGTCAGTGAATGATGGGCT
TTTCCACACGGTGGAGGTGCTGATCCAGAATCAGACACTG
AGTTTGGTGGTGGATAAAGGGACTCCTAAAAGCTTGGGCA
AACTCCCCCGTCCCCCTGCTGTGGACCACAACACACAGCT
ATACATAGGCGGTGTGCCATCTCTGATTGGCACATCAGGC
CTTCGGCCGGGCCCATTCCAGTCCTTCAACGGCTGCCTTC
ATGACGTACGCCTGAATGGAGAGCTCCAGGACCTCGGTGC
TGGACTGGCGGGGATAGAAGGCGTCCTGTTTGGGTGTCAC
TCCTGCAGCGTCTGTGACCAGGGAGCCTGCAGACAAAGAG
GAGACGAAGGGGTGACCTGTGACTGCCCCACAGGACACAG
CGGCCCACTATGTGAACAGATGAGCTCCCAAGACCCCTGT
GAAAGCAGCAGGTGTGTTCATGGGGAGTGTGTGGCGAAGG
GCTCGTCGTACAGCTGTTTATGTGTGGATGGATACTCAGG
CCAGTTCTGTGATAGACAGGACGAGTCCAGCGCCTGCAAG
GGACTGCACTGTGTTTATGGAGAGTGCAGACTGACGGAGA
GCGGAGAGCCCGCTTGTCACTGCCAGCCTGGATACAGCGG
GCCAACCTGCGAAACAGAACTGACATGCGAAGGAGAAGCA
GTTCGTGATTATCTGTATCGCCAAATGGCTCATAAAATCT
GCACGTCCACCAGCAGAGTCCAGCGGCTGGAGTGTCGCCA
CTCCTGCTCATCTGGGCTGTGCTGTGCTCCCACCAAAAGC
CGGAGACGGAAGCTCAGCTTCAAGTGTCCCGATGGATCAT
CCTTTTCCGAGGAGATGGAGATCACTGTGGAGTGTGGCTG
CACAAAGTGCTCATCGTAATTAAAGAACACCTCAGCCCGT
CCCAGGACCAGCAGAAGAATAGGATGAGGGAGCGCAAAAG
AAAATATATTGTAAAATAAACAAAACACAAATAGAACTTA
TTTTTATTAAGGGATGTTTTTTTAAAGAAAGAGACTGTTT
TTATGATGTTGCCTTTATGTGTCATAAGAAAAGTAATTTT
GTATCAATAAATAAAACAAATACACAGATTAACATTCCTG
AAAATATATGAATTATATAAATATGTATAAATCTATATAA
ATGTACAAGCTAACCTAAGAATTCATTTGGTCTGTGTATT
GCATGTCATTGTGTGAAGTGTGAGAGCGGAGAGACATTTT
TTATGGAGGAGCAAGGACTCTTGACTCTATATCACAGGAA
GTGGTGAGCCGACTTCCTGTGCTTTGGCGGCAGTAAAGGA
ACTGCCTCCTGACAGACCTGCAGATTTCAAGGAGAATGGA
CTGATATTTTGTACTTTGGGTGTTTTGTGTTGTTGTTTTT
TTGGCTTTGCTCCTTCAGAGAGATAGAGAGAGACATGGAG
AGCTCATCTGGGTGACTCTGGTTTACAAGCTGCAACTCAT
CGGAGTGTTTTTTTGCATGACTGCATGGAAAAGTTAAATG
TGAACTTGTAACATGCTGCGGTCAGGCAGTAAAGCTGTTG
CTATCTCTACCTGTTTTCCTTTACAGTTCAAATGCATTTC
CATTGTCACCGAATGGGCAGGCCATACAATCTCTGGTGCA
AAGCACTTCATACTGACGCCGTATTCCGTCTTAACCGTCC
TTTACTAAAATATTAAATGCAAATATGTTACACCCATTAC
TACTGTATTGTTTCATGTGTACCCTTTTTGTTTATTTGAA
CTTTTCAGATGTAACACTCAGTGTCTTATTCGAAGAGAGC
GAGGTCTATAGATTTTCCAAAGGAAAAGTGAACCAGTGTT
ATTGAATATTGGGCCTCGTCCTGTCTTTAACTCCCGTTGG
CCCCACATACTGATAAATGAGGTACAGCAGATTTAGGTAT
CCCCAGTCAATAATGTAACTGAGCTTGTGTGCACCGTGCG
TCATGTTAGCAGCGGTGCATTTTCTAATAATGTTTTGTTA
AAAATGAATTAGAGAGTGACGATTAACTTACAGTGAATGT
TGAATTAAACTTGTAATGAAATACAA

slit3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA slit3-202 6146
ncRNA slit3-002 (1)    Ensembl 1244
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slit3-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000026451 (1),  Ensembl_Trans:ENSDART00000146299 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AF210320 (1) 4548 bp
GenBank:CT612235 (1) 865 bp
GenBank:DN861082 (1) 858 bp
GenBank:CT674061 (1) 813 bp
GenBank:CT612236 (1) 805 bp
GenBank:CT607630 (1) 803 bp
GenBank:CK146951 (1) 780 bp
GenBank:CT708382 (1) 668 bp
GenBank:EB909811 (1) 590 bp
GenBank:EB935074 (1) 580 bp
GenBank:EB781469 (1) 560 bp
GenBank:EB788306 (1) 509 bp
GenBank:EB771346 (1) 407 bp
GenBank:CD586649 (1) 320 bp
CITATIONS (2)