ZFIN ID: ZDB-TSCRIPT-090929-9111
Transcript Name: tmem50a-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026436 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026436|OTTDARG00000020952|ZDB-GENE-040426-2937 tmem50a|no_translation tmem50a-002 LG_ BX465191.6 Danio rerio protein_coding KNOWN, 923 bp
CACATTTGTAAAGTGCTGGAAAATGAAAAGGCGTGAGAAT
GCTGAGAGAACAAGTGCTTGTATTCGTTGTGTCCATTCAG
TCTAACTGTCTGACATAAGTTGATCTGGCCTAGATCTTTC
TTCCTGTTCTTCATCTGTGATTTGCCTTCAGAGTTGTTCA
TTGACTACTTCACCATGACTACTTTGTTTAACCATCTGTT
GAGTTTCACTTTCTGTGGATTTGCGTGCAGGATCAATGCA
GTGTCAAATGGCCAGGTGAGAGGGGACAGCTACAGCGAGG
GCTGCTTGGGACAAACAGGTGCTAGAATTTGGCTCTTTAT
CGGGTTCATGTTGGCATTCGGGTCTCTCATCGCCTCTATG
TGGATTCTGTTTGGTGGTTTTGTTGTGACTGGAACAGAAC
ATAAGGATCTGTCTGTGTATCCTGGTATTGCAGTTTTCTT
TCAAAATGCATTCATCTTCTTTGGTGGTCTGGTGTTCAAG
TTTGGCCGAACTGAAGACCTCTGGCAGTGAGGATCCATGT
CCATCAATCAAATCCCACAGTCCATCAACACACAGTTCCT
CTCTACTTACTGCTGCTTATTTGCACTCTCTATTTCTTTC
TCTCCTCTTTTTCAATGACGACTCCTCTTAAATATTCTCC
TTTCTTCGTCTCCGTGTGGTCACAGTAGGTGAGAGAAATG
CAAATCAAACCAGTTGAAATGGACACTATCCTGCCCTTAT
TATACACATACTTCATAATATAGCGCACCATAGAGGATAT
CTTCAGCCTGGCTGTTTCAAAATCACAAAAATATGGACAG
CATAATGATATATTTACATGATTATTACGCTACAGGGCGG
TGGGAGAGTTTCTGAACAGATTCTTTATTAACCAAAACAA
GCATTGCTGGCTTTCGGCTTCACTGTGTTTCTTTTTTTAT
TGC

tmem50a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA tmem50a-203 (1)    Ensembl 1687
tmem50a-204 (1)    Ensembl 582
ncRNA tmem50a-002 923
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmem50a-002 Contained in:
[BAC] DKEY-9G4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000026436 (1),  Ensembl_Trans:ENSDART00000133635 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EE309601 (1) 894 nt
CITATIONS (2)