header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9110
Transcript Name: tmem50a-203
Previous Name: tmem50a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026435 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026435|OTTDARG00000020952|ZDB-GENE-040426-2937 tmem50a|OTTDARP00000021686 tmem50a-001 LG_ BX465191.6 Danio rerio protein_coding KNOWN, 1687 bp
GCAGGGCGCACTGCGCATGCGCGGCTCAGATCCACTGTAG
GAGACGGAAGACTGCGGAGTGAATCTCCAGTTACTGCGAA
GCACTAGAAAAAAACTCAAGGAAAGTACAGGTCAGATCAG
CAGAATGTCGGGATTTCTGGACGGGATCAGATGTGGCGAT
TGCGAGTGTAATGTGGACTGGGGCGAGAAGAGAAACACCA
TCGCCTCCATCGCAGCTGGAGTTTTGTTTTTTACAGGCTG
GTGGATCATCATCGACGCAGCGATAATGTATCCTAAAGAG
GAACAGTTCCACCATGCGTATCATACCTGTGGCGTTATAG
CCACTATAGCCTTCCTCATGATCAATGCAGTGTCAAATGG
CCAGGTGAGAGGGGACAGCTACAGCGAGGGCTGCTTGGGA
CAAACAGGTGCTAGAATTTGGCTCTTTATCGGGTTCATGT
TGGCATTCGGGTCTCTCATCGCCTCTATGTGGATTCTGTT
TGGTGGTTTTGTTGTGACTGGAACAGAACATAAGGATCTG
TCTGTGTATCCTGGTATTGCAGTTTTCTTTCAAAATGCAT
TCATCTTCTTTGGTGGTCTGGTGTTCAAGTTTGGCCGAAC
TGAAGACCTCTGGCAGTGAGGATCCATGTCCATCAATCAA
ATCCCACAGTCCATCAACACACAGTTCCTCTCTACTTACT
GCTGCTTATTTGCACTCTCTATTTCTTTCTCTCCTCTTTT
TCAATGACGACTCCTCTTAAATATTCTCCTTTCTTCGTCT
CCGTGTGGTCACAGTAGGTGAGAGAAATGCAAATCAAACC
AGTTGAAATGGACACTATCCTGCCCTTATTATACACATAC
TTCATAATATAGCGCACCATAGAGGATATCTTCAGCCTGG
CTGTTTCAAAATCACAAAAATATGGACAGCATAATGATAT
ATTTACATGATTATTACGCTACAGGGCGGTGGGAGAGTTT
CTGAACAGATTCTTTATTAACCAAAACAAGCATTGCTGGC
TTTCGGCTTCACTGTGTTTCTTTTTTTATTGCGCGTTGGT
CATTTGAATAAACATAAACCACCCGATTTGTATATTTTGA
AACACTTTAATGTATGACGACGTTTAATTTCACGTTCTGT
CAGAATTTGTGTTGATTTTGCTGTCGTATTAACCGAACGG
CTCAACTGACTTCAATCGCGACACTACAGCGTACTTTTGG
ACGATTTTATGTTATGTTATATGGGTTCACACAGCTTTCT
CAGACATTTGTCATGATTGATTTTTAACAATTATTTTACA
GAGAGCATCTTTGAGCTGATCTACATTCACTGTCGACATT
TAAAACGTTTTTTTTTTTTTCCTCAGAGTTTGCAACAGAA
CCAAACAGAAAGAGTTTTGCTTGACTGTGTGAACGAACCC
TTGTTATATATTTGTGTTCTGAAGCTTTAAGTTGACTCTC
TCTATGTTCGGGCATGTGGGAGTTGTATAAAAGATGTTTT
TTAAAAGCACAATTTCTTATTATTTCTTATTTCAGTAGTT
TATGGAAGATTGATAATTCGACTTGTCTGTTAAACTAACA
AATTAGGGGATTTCTACATGCTAAAAGAATGTAACATTTT
AATGTAATCCACTTTTTCTGACTAAAAAAAAGTAGCTAAA
ATTCATCAACTGTGGGTTTAAAATGAAATAAAATTATTGT
AAATATG

tmem50a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA tmem50a-002 (1) 923
mRNA tmem50a-203 1687
tmem50a-204 (1) 582
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmem50a-203 Contained in:
[BAC] DKEY-9G4 (1) (order this)
OTHER tmem50a-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026435 (1)
  • Ensembl_Trans:ENSDART00000134730 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC044368 (1) 1699bp
    GenBank:DN836061 (1) 816bp
    GenBank:DV585648 (1) 761bp
    GenBank:CT691987 (1) 583bp
    GenBank:EB793400 (1) 502bp
    GenBank:EB835983 (1) 464bp
    GenBank:AW076963 (1) 462bp
    CITATIONS (2)