Transcript

fancl-003

ID
ZDB-TSCRIPT-090929-8788
Name
fancl-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026095 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026095|OTTDARG00000020754|ZDB-GENE-040426-1045 fancl|no_translation fancl-003 LG_ CR354594.13 Danio rerio protein_coding KNOWN, 715 bp
TATTTATTGGTAAACCGACTGTCATGAGCGCCTTATTGTT
GATATTAAATCTTTAATAGGAAAAAGACTTCAGGATAAGA
ATATCTCTACCCCCTGATCATCAGATGAAACGAGCAAAAT
TGCATTGTTGTTGGCAAATGAAGCGGCTACTTCATGGTTA
TCAACATATTGTGAAGCAGAGATTACAGCATTCAACTACT
TTGATGGCTTTTATCCTGGAGCTCAGGACAGTATTGGAAG
TGGCATTGAAGAGCCAACCAGGATGTCAGTCCTTCTCACC
ACCTCAGTATTATTCGCAGCTGATAACAGAGATGGAGATC
TTGGGATGGGATAAACTGCTTTTCATTGATGCAGAGTTTC
GCACACTCCAGCTGAAGGCAGAGGACTCTGCAGGTCGTCA
GCATGCCATTACTGTAAAACTCAAGTCCAAGTATCCAGCT
GAGGCTCCAGAGTTTTCTGCGGATCTTCCAATTCCTCTGG
TCATCACGTGGACCTCTCAGAGCACCTTGGCCAACGTCCA
CAGCCAGTTCCTGTTAAACGTTGAGGCTCTGTCTGACTTT
TGGTCAGTGCTGGATGAGATCGATGAGAAGACATGGGTGC
TGGAACCAGAAAAGCCCACAAAAGCAGACTCCACCAGAAG
AATCGCCATTGGAAACAATGTCTCAATAAAGGTACAAATT
GACCCCAGACACCCCAAAATGCTGCCGGAGTGCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations