Transcript

fancl-201

ID
ZDB-TSCRIPT-090929-8786
Name
fancl-201
Previous Names
  • fancl-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026093 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026093|OTTDARG00000020754|ZDB-GENE-040426-1045 fancl|OTTDARP00000021431 fancl-001 LG_ CR354594.13 Danio rerio protein_coding KNOWN, 1945 bp
TTCACAGCGGAAGAAGATTATTACAGCAGCGATTGACTGT
TTTCCGCAACAACAACAAACAGCACGCTTTTGTCGGTGTT
TTTTTAGTTTGATGTCTAGTACTATCGAATGCCGTTTCAG
GTACTTGGTTAGCGGTATTTATATTCACGTTGTGGTTTGC
CATAATTCTTGTTCATCATGAGCTGCTTGCTGATGAGAGA
CAGCCCTTTGATCATTGCGCTAAATAAAGAGAAGACGCTC
TATGACGGCTTCATCACAGTGCTGGAAAAAGACTTCAGGA
TAAGAATATCTCTACCCCCTGATCATCAGATGAAACGAGC
AAAATTGCATTGTTGTTGGCAAATGAAGCGGCTACTTCAT
GGTTATCAACATATTGTGAAGCAGAGATTACAGCATTCAA
CTACTTTGATGGCTTTTATCCTGGAGCTCAGGACAGTATT
GGAAGTGGCATTGAAGAGCCAACCAGGATGTCAGTCCTTC
TCACCACCTCAGTATTATTCGCAGCTGATAACAGAGATGG
AGATCTTGGGATGGGATAAACTGCTTTTCATTGATGCAGA
GTTTCGCACACTCCAGCTGAAGGCAGAGGACTCTGCAGGT
CGTCAGCATGCCATTACTGTAAAACTCAAGTCCAAGTATC
CAGCTGAGGCTCCAGAGTTTTCTGCGGATCTTCCAATTCC
TCTGGTCATCACGTGGACCTCTCAGAGCACCTTGGCCAAC
GTCCACAGCCAGTTCCTGTTAAACGTTGAGGCTCTGTCTG
ACTTTTGGTCAGTGCTGGATGAGATCGATGAGAAGACATG
GGTGCTGGAACCAGAAAAGCCCACAAAAGCAGACTCCACC
AGAAGAATCGCCATTGGAAACAATGTCTCAATAAAGGTAC
AAATTGACCCCAGACACCCCAAAATGCTGCCGGAGTGCTG
TTTGCTCGGGGCTGAGCACGTGGTCACTCCTTTAAGGAAT
AAGTTGAATGCCAATATGCATTTATGGAACCCTGACTGCA
CTGTCCTACAGAATATGAAAGATGTGTTGGAGATTGAATT
TCCATCGCCTACCACCCACGAAAAATCTAGTTTCAGTGTT
GAATGTGGAATCTGCTATTCTTATCGACTTGAGTCAGCCA
TTCCAGATCAGGTCTGCAATGACCCACGTTGTGGCCAGCC
TTTCCATCAAGTGTGTCTTTATGAGTGGCTGAGAGGTCTG
CCAACCAGTCGCCAAAGCTTCAATATTGTGTTTGGAGAAT
GTCCTTACTGCAGCAAGCCCATCACTGTGAAAATGGTCAC
AGGAAATGCTTAACAACAGTCTGTTCATTCAGAGTAGCGT
TGTGTGGCATTACGGCTCCAGCGAGGATAAAACCAACAAC
CAACAGCTGCTAATATCAGAACAACCAGGAAAGTCAATAG
TCTTTTGAATGACCATTTACTCTGATTTATCGATTTTCCG
AATCCACTTCCTCTTCTGTGATTCCGTTTAACTTTCAGTT
CACATACATCACTTCCCCAGTGGTCTTCATCCTCATCATC
AGTTTCGTCCCATTGTGTTTTCTCCCAGGTGTGTTTGTTA
GTACAACTCCTCCAGTAGTCAGCTTTACTGCTGGCTACTG
CATAGTTGTCATCAATTGATCGAGTACTGTTTTGTTGGTT
GTCATACTGGTGGTTTTGTCTCCTGTTGGTCATCCAGGTC
TTGCCCTCATAAACATCTTCATTCTTTTTTTCCTGTGTTG
TTAAAGTAAGTTAGTTTTTTCCCACACAGTATGAGGGCTT
AATGTGTTAATACACTATTGTTTCAAACGATAAACACTGC
ATACTACATACATCTGAGCCAGAATCCATCATTTTCTGCA
TTGTTTACTATATTTTTTGTTATATTTTTAAATCTTTTAT
GTTGATTGTAAAGTGCTTTGAGCATAGAAAAAGCTCTAAA
TAAATAAAACGTATTCATTAAACTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations