Transcript

fancl-002

ID
ZDB-TSCRIPT-090929-8787
Name
fancl-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026094 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026094|OTTDARG00000020754|ZDB-GENE-040426-1045 fancl|no_translation fancl-002 LG_ CR354594.13 Danio rerio protein_coding KNOWN, 570 bp
GGGAAGTTACTTTCGCTTTGCTAGGTTCACAGCGGAAGAA
GATTATTACAGCAGCGATTGACTGTTTTCCGCAACAACAA
CAAACAGCACGCTTTTGTCGGTGTTTTTTTAGTTTGATGT
CTAGTACTATCGAATGCCGTTTCAGGTACTTGGTTAGCGG
TATTTATATTCACGTTGTGGTTTGCCATAATTCTTGTTCA
TCATGAGCTGCTTGCTGATGAGAGACAGCCCTTTGATCAT
TGCGCTAAATAAAGAGAAGACGCTCTATGACGGCTTCATC
ACAGTGCTGATTGCATTGTTGTTGGCAAATGAAGCGGCTA
CTTCATGGTTATCAACATATTGTGAAGCAGAGATTACAGC
ATTCAACTACTTTGATGGCTTTTATCCTGGAGCTCAGGAC
AGTATTGGAAGTGGCATTGAAGAGCCAACCAGGATGTCAG
TCCTTCTCACCACCTCAGTATTATTCGCAGCTGATAACAG
AGATGGAGATCTTGGGATGGGATAAACTGCTTTTCATTGA
TGCAGAGTTTCGCACACTCCAGCTGAAGGCAGAGGACTCT
GCAGGTCGTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations