header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8725
Transcript Name: zic5-201
Previous Name: zic5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026029 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026029|OTTDARG00000020716|ZDB-GENE-040622-1 zic5|OTTDARP00000021381 zic5-001 LG_ BX469902.7 Danio rerio protein_coding KNOWN, 2587 bp
GTGGGAAAAGGAGCAAGCAGAGTTAGAGGCAGGACAAAAG
AAGTTCTATAGACGGCCATATACATATATTTTAATGGTTT
CAGAAGGCCCGTAGTTGGCGAAAACAATAGCGTTGAGCGT
GGACATGACAGCGTAGTGATGGAGCCCCCTTTAAGCAAGA
GGAATTCGGCGATAAGATTAGCGGATTTGGCATCGACTCA
AGCCCTTCCTCATCAGAATATGACAGGCTTCCCGGGGATA
GGGGGGCATCACCCGCACTCCCACCATGCCCACCTCCACC
CTGGGGAGATGGGCAACGACCCCGGAGTGGCTCTCACTCC
ATTTGGACCCGAGCACATGGCACAGACCAATGCTCTCAAA
CTTAGTCCATCTCAGCCTGTTCAAAGCCATCCCGAAGCCC
AGACCGCGGCATCTTTCACGTCTTCTCAGACTACAGTTGG
TTTCCCCGTGGCTCACCCCCACACAGGCTACACCACCAGC
AGGGACTTCATCCTCAGGAGAGAGCTCTCAGCCTCTGCTA
TGCATGCACTTGGCGACCAGCATAGTTCCGCCTCCTCCCC
TCATCACCATGGCATGTTCATTTCCCCAACAGGTGCTTAT
GGGCACGCGGAAGGTGGTGCCCATCCACTTTTCTCTGGAC
TGCACGAGCAAGCGGCCCCAGGTGCCCACCACCACCACCA
TGCCCTCAACGGGCAGATGCGCCTGGGTCTACCGGGGGAC
ATCTACGGCAGGCCAGAGCACTTCGGCCACAGGCCCGAGC
ACTATGGATCTTCTTCTCTGCACAGCTACAACTCCATGAA
CTTAAATGTGAACCTCGCCACGGCTCCTCACGGAGCCACG
GGGGCGTTTTTGCGATACATGCGGCAGCCCATCAAGCAGG
AGCTCATCTGCAAGTGGATAGACCAGGAACAGACTGCCAA
GAAGCCCTGCTCGAAAACTTTCAGCACCATGCATGAGCTC
GTCAACCATGTCACAGTGGAGCACGTTGGCGGACCGGAGC
AGAGCACTCACGTTTGCTTCTGGGAAGAGTGTCCGCGCGA
GGGAAAAGCGTTTAAAGCCAAGTACAAACTGATCAATCAC
ATCCGCGTGCACACTGGCGAGAAGCCGTTCCCGTGTCCTT
TTCCAGGTTGTGGCAAGGTATTCGCGCGTTCGGAAAATCT
CAAGATTCACAAGAGGACGCACACAGGTGAGAAGCCATTC
AAATGCGAGTTTGATGGCTGCGACAGGAAATTCGCCAACA
GCAGTGACAGGAAGAAGCACTCGCACGTCCACACAAGTGA
TAAGCCTTACTTCTGTAAAGTGAGGGGCTGTGACAAGTCG
TACACACACCCGAGCTCTCTGCGCAAACACATGAAGGTTC
ACTGCAAGTCTCCTCCGCCCCCTTCCGCCAACACGGGCTC
TTCTTACCATCCCTCATCTACTACGATCGGTGATGCCCTT
TCACCAAACCTAGATCCCCACAGGAACCGTTCGTCGAACC
TTTCTCCTCAGGTGACCAACCTAAACGAATGGTACGTGTG
CCAAGGGAGTGCTGGACCAAATAATCTACACACCCCCTCC
AGTGATGTGCCAACGTCGGAATCCGACGACGAGGACTCTT
TCAGACACACAGATCCAAGGGCAATGCTCTGATGTGTACA
GCAAGGAATATATTCAATATGAATGGTCCACGTAAAAAAA
GTCAGTTCGTAAAAGTGGAACACCTATGGATGTCAGTGGG
TGAAAAGTTTTGCCCCCCAGTTTGCCCTTAAAACATGCTC
AGAGCATTGATGCAATTTATGTTCCATATAATAATCACAT
CCATTATCAGTTGCAACTTGCTAGATATGAAACCGACTTG
TCCATGTTTTTAAGATTTTACCTGACTTGTCATCAAATAT
CATGAGCTCAAAAGATGTGTCATGTTTAGGTCGTTTTTGT
AATAATACATACCCTTTGTTGCACAAAAACCTTTTTATAG
ATAATTTTACACGTTAAATGTCTGAGGGGCAAAAATTGCT
GTGACAATAATTTTGAGTTTTTACTTGTATATTGTCAGTG
TCAAAAATGAATGGGTGGAGTTTTTGTTAAAGTTTATACA
ATAACTGTGGTCAGGACGGTTTTTGTGATATTTAAAATAT
TTAAACCTATATTTTATGCAAATAATTGTAACTCTGATTA
AGGAGTACGAAATATGTCCACTGAGACCCTAAATAATGTA
TCGTTGATAGGCCTATCTCTGACTGATTTGTAAATATTAT
ATGGTATTGATGCTTGTGAATGTTTTCGTAGCGTCTCAAC
GAGTTTTGTACATTGTAATTTATTTGCTGTTATTAATGTT
GGTCTGGAAGTACAGATACACCAAAGAATAATATAATTTT
GGTGAAAAGAAGTGATGCTTTTTATCGTGTTCTGTAAAAA
AGGTCTTACTTGAATAGGTTGTATAATGTGAAGAATCGTT
CGCATGAACCGTGTAGTTTTCTGTTGAGGTGCATGATGGT
ATTGATGGAAAAAAGTAAGAAGGTCGTGAAGAAATGTGAT
GTTTGTGTATAGATATATAAACTTGAATAAAAGGCAGGAC
GTGTAAATATGGTCTTTTCAGTAAAAA

zic5 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA zic5-002 (1) 1887
mRNA zic5-201 2587
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zic5-201 Contained in:
OTHER zic5-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026029 (1)
  • Ensembl_Trans:ENSDART00000022204 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY326458 (1) 2599bp
    CITATIONS (2)