header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14788
Transcript Name: zic5-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033858 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033858|OTTDARG00000020716|ZDB-GENE-040622-1 zic5|no_translation zic5-002 LG_ BX469902.7 Danio rerio protein_coding KNOWN, 1887 bp
GGCTCATGATTCAGTTTGAGTCATTTGAATCATGATGAGT
CGTTACAAAAACATTCTATGCTCTTTTTTCGTTTATTCTG
TGACGCACAGACAGAAACCGTTGACTTTCTCAAATTCTCA
TCGTTAAACAGTAGCGAGATTCTTTTGGACTCAAACGACA
GGATGAACAACATTAATATCCTTAAAACTGAAATAACAAA
AGCGTTCTGTCAGCGAAGAGGAAGCTTCAACGCTTGGGCA
CGCTATTTACCGCCATTGTTCTGCAGGTGTCACCAGTCAA
GCCATTGACTTCATTAGCACAAGAATTGAGGAGTCATTCT
CACTTTGAAAAAAGTCCCTGAGAACAGTCAAGCTCTGTAA
ACTGCTCGGGTTTTCTATACGGATCAATATCAGAGCAGCA
TGCGCTGAGAAGGAAACGCCATCCAAGCTCGGCAGGACGC
TGACCTTTCACTCTACCTACAGGTCACATCATCCTCCCCT
AAACAGGTGAGAAGCCATTCAAATGCGAGTTTGATGGCTG
CGACAGGAAATTCGCCAACAGCAGTGACAGGAAGAAGCAC
TCGCACGTCCACACAAGTGATAAGCCTTACTTCTGTAAAG
TGAGGGGCTGTGACAAGTCGTACACACACCCGAGCTCTCT
GCGCAAACACATGAAGGTTCACTGCAAGTCTCCTCCGCCC
CCTTCCGCCAACACGGGCTCTTCTTACCATCCCTCATCTA
CTACGATCGGTGATGCCCTTTCACCAAACCTAGATCCCCA
CAGGAACCGTTCGTCGAACCTTTCTCCTCAGGTGACCAAC
CTAAACGAATGGTACGTGTGCCAAGGGAGTGCTGGACCAA
ATAATCTACACACCCCCTCCAGTGATGTGCCAACGTCGGA
ATCCGACGACGAGGACTCTTTCAGACACACAGATCCAAGG
GCAATGCTCTGATGTGTACAGCAAGGAATATATTCAATAT
GAATGGTCCACGTAAAAAAAGTCAGTTCGTAAAAGTGGAA
CACCTATGGATGTCAGTGGGTGAAAAGTTTTGCCCCCCAG
TTTGCCCTTAAAACATGCTCAGAGCATTGATGCAATTTAT
GTTCCATATAATAATCACATCCATTATCAGTTGCAACTTG
CTAGATATGAAACCGACTTGTCCATGTTTTTAAGATTTTA
CCTGACTTGTCATCAAATATCATGAGCTCAAAAGATGTGT
CATGTTTAGGTCGTTTTTGTAATAATACATACCCTTTGTT
GCACAAAAACCTTTTTATAGATAATTTTACACGTTAAATG
TCTGAGGGGCAAAAATTGCTGTGACAATAATTTTGAGTTT
TTACTTGTATATTGTCAGTGTCAAAAATGAATGGGTGGAG
TTTTTGTTAAAGTTTATACAATAACTGTGGTCAGGACGGT
TTTTGTGATATTTAAAATATTTAAACCTATATTTTATGCA
AATAATTGTAACTCTGATTAAGGAGTACGAAATATGTCCA
CTGAGACCCTAAATAATGTATCGTTGATAGGCCTATCTCT
GACTGATTTGTAAATATTATATGGTATTGATGCTTGTGAA
TGTTTTCGTAGCGTCTCAACGAGTTTTGTACATTGTAATT
TATTTGCTGTTATTAATGTTGGTCTGGAAGTACAGATACA
CCAAAGAATAATATAATTTTGGTGAAAAGAAGTGATGCTT
TTTATCGTGTTCTGTAAAAAAGGTCTTACTTGAATAGGTT
GTATAATGTGAAGAATCGTTCGCATGAACCGTGTAGTTTT
CTGTTGAGGTGCATGATGGTATTGATGGAAAAAAGTAAGA
AGGTCGTGAAGAAATGTGATGTTTGTGTATAGATATATAA
ACTTGAATAAAAGGCAGGACGTGTAAATATGGTCTTTTCA
GTAAAAA

zic5 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA zic5-002 1887
mRNA zic5-201 (1) 2587
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zic5-002 Contained in:
OTHER zic5-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000033858 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DN766599 (1) 767bp
    CITATIONS (1)