Community Action Needed: Please respond to the NIH RFI
Transcript

efnb2a-201

ID
ZDB-TSCRIPT-090929-8639
Name
efnb2a-201
Previous Names
  • efnb2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025935 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025935|OTTDARG00000020664|ZDB-GENE-990415-67 efnb2a|OTTDARP00000021308 efnb2a-001 LG_ CR391949.7 Danio rerio protein_coding KNOWN, 4598 bp
ATGGGCGACTCTTTGTGGAGATATTACTTTGGAGTTTTAG
TGATCGCGTGCAAGGTGAACCTGTCCCGCGCGCTCATCCT
GGACTCCATATACTGGAACACCACGAACACCAAGTTTGTG
CCAGGACAGGGTCTGGTGCTGTATCCGCAGATTGGGGATA
AGATGGACATAGTTTGCCCACGTGTGGAAGGTGGTTCAAT
GGAAGGAGTGGAGTATTATAAACTCTATATGGTTCCTCTG
GAACAGCTAAAGTCCTGTCAGGTCACAAAAGCAGACACGC
CTCTACTCAACTGCGTCAAGCCAGACCAGGACGTCAAATT
CACCCTCAAATTCCAGGAGTTCAGCCCAAACCTTTGGGGC
CTGGAGTTCTTCAGAGGGAAAGACTACTACATTATCTCTA
CATCTAATGGAACAATGGAAGGGCTGGATAATCAGGAAGG
AGGGGTGTGTAAAACCAAGTCGATGAAAATCATCATGAAG
GTTGGACAAAACCCCTCTGATCCCATTTCCCCCAAAGACT
ACCCTACCAGTTACCCTCCCAAACACCCTGACTTAGGGGG
CAAGGACAGCAAATCGAATGAAGTACTTAAGCCAGATGCA
TCTCCTCATGGGGAAGATAAGGGAGATGGAAATAAATCCT
CATCAGTCATTGGCTCAGAGGTGGCCCTGTTTGCCTGCAT
CGCCTCAGCAAGCGTCATCGTCATCATCATAATCATCATG
CTAGTTTTCCTTCTCCTGAAGTATCGACGACGTCATCGCA
AACACTCTCCTCAACACGCCACCACGTTGTCACTCAGCAC
ATTAGCCACGCCCAAGAGGGGCGGCAGCGGCGGCAACAAC
AACGGCTCAGAGCCGAGCGACATCATCATCCCACTGCGGA
CTGCTGACAGCGTCTTCTGCCCGCATTATGAGAAAGTGAG
CGGCGATTACGGACACCCTGTTTACATCGTACAGGAAATG
CCGCCACAGAGCCCAGCAAACATCTATTACAAGGTGTGAA
AATGGACACGCTATTTTTTCCCGGACATTTTAACTCTAAC
CCCTCACATGCCCCTCGATGAACCCCCAGTTGGCGGCATC
GATGCCTGAGCTCACCCTCGTTCTGCCCCCTCTTATTTTA
TTTTGTTGTTCTTGTTTATTTTACATTATTACTCTCAGTA
TAGATGTTGCTGATGGTGGAGTAACACTCCTGATTCGCTG
CTCTTGCACCTGCAAAAACGAGACAAACTAATAGACAAAT
GACAAAAATGGAAACCCTCCGGGGGGACTGATGTGCACTA
TAATGGATACTATAGTGTGTGTACGAGGAAGCGTGTGTGA
ACGAACGGGGGAGAGGGGGGTTGAGAGGGTGGGCACGAAA
AGAGAGGCCAAGAAAACGATTCTTCCTCTTTTTTTCCACT
ACATCATCTCCCTTAAGGACACAACATGCGGAGATGAAGA
GAAGCGGCGTGTATCACACAACCACAAATAAGAACTTGAG
CTGTTTATTTAGCTCGGCCGATCGGCTGATCCGTCACAAA
ACAGGAAGTGAACACAGCCCATTGGTTAGAGGAAGTGGAT
TTATTGAGGATGCTCTCCGGAGCGTAATGTTGGACATTTG
AATGGACATCATCTGTTTTTGCACGTTCACTCGTACTGTT
TTCATTTACGTTAGCTCTCCTCATTTGCTCACCTCTACAA
AACGGCTCACCATGTTTTACTTGAAGTCTTTTTGTATGGT
CATTCGTCTTACTTGCATTTCTTTCTGTCATTCCCAGTGC
AGTCCACTTTGCAGATTTGTTTGGTAGAAGATTAATAGGT
ATCGTCATAGATATCCTTTTGTGCTGGTTTATGTGCCGTT
TAGTAGCGTGGAAGACACACACACACTCACAAACACATTT
CATTGCATTTCACATACATCCGCTGCCGAGGCTGGAAAAA
CGAGACATAATGAGAGAACGTCAATATTTGGTACAGTTGC
TGTCCTGTTAACAGCTGGGAAGGTGGAGGACTCACATGAA
CACTTTAGCAGCACTTTGAAAGCCTCAACACCTTGCCCGA
TGGAGTAAAAATGCATCAAAACAGACAGAGATAGTAGGGA
GCGAATTGCTCAAGATTTATTAGCAAAATTGGTCATTTTT
GACACAAAATGGCCGCCTTTCCCAGCCATGTTGCTGCAGA
GGTTCCTGTTTTTCTAGTATTGCTGCCATCACAAACATAC
ACTCGTTCACCGGTGGCCAGTGGAAAAGAGCTCTATTTTT
TTGCTCAGAAGCACAGGGACATGGAATAATATCCCGATTC
TTTAGTTTTGAATGAAACAAGATTTCATTAGCCTTTCCTT
ATGGATTCGTCGAGCTCTCTATATGAAAAATGATTGCACA
TAGAACCCATTTTTATGATAGCATGCAGACAGGTCAGTGT
GAAACAGCAAGAATATGAATAATTTATGGCCAATCTGCAC
ATTATGCAACTTTCTTTTTCGTTTACAGATATTCCTCCAC
CTCGCCATTTGCCTTTTTCCATCGATCCCGACACGAATAG
CTGCCTTTCGACCACAAACAAACACACATATACATACCCG
CACAAAAAAGCACATGCGCTCATGGCCAGGGAAGGGGCGG
CTTGGGAAGGAGCCCTCAGGGAAAACAGCATGTTGGGTTT
TAAAATAGCCGAAAGGAATGAGAGGGAAGGGCCAGAAACG
GACCAAAGGAAGGGCACGTCTAACAGAGTCCTGACTAAAC
CAACTTCTCCAGCCTGCCTGTCTCAGTTGATGAAGCTCAG
ATGTGCTCTGAGTTGAAATTAGGCCCCTTAATCTGGAAGG
AAAGCAGTAGACGTGGGTTAGCAAGCATACCAGATGAGAA
CGAGCAGAGGCTAAATGTAGTAAATTGCATGAAATGGGAT
CTTTCGGGCTCAAATTGTGGGAGGTTTCTGGAGGGGAAAA
CCAAAAAAAGAAGAAGAGAAAAACACATTATGATCGATGG
AGGTCACAAGTGGACCTAGCTTGCGCTTTAGAGAGGAAGT
CACCAAGCAGAGGCCAGCGTATCCCATAACCAGCAACTCC
CAGAAGATTTACGTGTGTCGTTATTTGTGAGCAATGCCAG
CCTGTAGATGGTCAAACCCATTTGTTTTTTTGTTTTTCTC
ACATTAAAATCGCTCACCTACGGTGGACTTTGAGAGATGT
CCACTGGCTGACTGTGGACTTCCACAGTGGCACATTACCT
GTTCATCCATATTGTTTTCACTTGTTCATGGAGGTTCTTG
AATCTCACCGAGAAGCCAAGCCTTGTGTGATCGGAGCTTT
GTGCCTCTGTAAGAGGCCACAAAATCTGCAAATATGCAAT
TTTTATTTATTTTTATAACAATTGAGAAAAAAAAAGATGA
TATACGTTCACCTATGGAAAAGTGTTCTTAACCACTGAAA
ATTAAATGATACAATACAGCATACGAAAACACTACAACCC
CGGTGTGTTATTATTATTATTATTATTACTTTATTTTTTA
CTTTGTGCTGTAGGTTCGAGGTAAACTGTGAAACATGAAC
ACTTTTACACACACACACACTTACATACATATTGAAGACT
GAGCAGTTTTAAACTCTAAAACACACACACACACAAACAT
ACATACACACACAGATACTACAAAAAACTACAAACATGTT
GCTGTTTGGTTGCTGTCCCATATGGGCTAAATATGACAAT
CTCCTTAGTTTCTTCGAATCCGAAGACACTTTCCCGGCAA
GCAGGTTGCAAACGTTCCCGTAACATTTTAGGAGCGGTAG
GACTTAACTAGTAGCGTAAGATGTTGCACCGATGTGGGCG
GAAGGTTTGCGCAAAAGCAGGGACAAGTGTCTTCGGGCCA
CTGTAAAATGCCTTGCTTGTATGGTCACCCTGAGTTCACA
AGACTCTAGTTTTTGCACCGTACATCTGTAGGTAAGAGGC
TGTAAATATGTTATTGTTTGTATTGTATATGGATCCCCGG
TTGTTACGATAGCCTTATTCTCACATTTCTAGCAAATAAA
AAAAAAGTTAAGGAAAAAAAAACATGAATCACTTCAGTTA
AGAGAGCATACTAATTTTTTTGGTAAATAACTTGTGTAAA
TATTGACGACGAACCCAATAAATCGTTTTTTATAAACTCT
TAAGTAAGATGTTTTGTATAGAATTGGAATTTTTTGCTAT
GTATTTTAGCTAGCACTCGTCAGACCCCTCCCACTCAACC
CTTTTGCACTGTTCCCAATGGCGATCTGGTATAAAAATGA
AAATGAGATAGAGAATTGCCAAACTGACTGCTTGCTGCAT
ATTTGTGCCATACGTGTGTACCATAGATATTTATTTAATT
AGTTCTTTTCGTTTCTTCTTTGTTTGTTTCTGTTGGATTT
TTTTCTACCCATTTTGTACGCAACCTCAGTATTACCATTT
GAGTTTTTATCCCCCCGACCTCTCCATCTCCTGTAATCTT
TCTGTTGATATCGTTTCCCGATGCGCCCGTTTTCTCTCGC
AGTAAGATCTGGTCAGGACGTGCAAACCTTATACAAGTCA
TAGAAATGAAATGGCACACATTCCACCAGTCTGTTACAAA
CTGAAAATGTTTTTCAATAAAATGTTTTTCCTATGGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations