Community Action Needed: Please respond to the NIH RFI
Transcript

efnb2a-003

ID
ZDB-TSCRIPT-090929-14701
Name
efnb2a-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033759 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033759|OTTDARG00000020664|ZDB-GENE-990415-67 efnb2a|no_translation efnb2a-003 LG_ CR391949.7 Danio rerio protein_coding KNOWN, 840 bp
GTGTTTTGCAGACCCCTCTGATCCCATTTCCCCCAAAGAC
TACCCTACCAGTTACCCTCCCAAACACCCTGACTTAGGGG
GCAAGGACAGCAAATCGAATGAAGTACTTAAGCCAGATGC
ATCTCCTCATGGGGAAGATAAGGGAGATGGAAATAAATCC
TCATCAGTCATTGGCTCAGAGGTGGCCCTGTTTGCCTGCA
TCGCCTCAGCAAGCGTCATCGTCATCATCATAATCATCAT
GCTAGTTTTCCTTCTCCTGAAGTATCGACGACGTCATCGC
AAACACTCTCCTCAACACGCCACCACGTTGTCACTCAGCA
CATTAGCCACGCCCAAGAGGGGCGGCAGCGGCGGCAACAA
CAACGGCTCAGAGCCGAGCGACATCATCATCCCACTGCGG
ACTGCTGACAGCGTCTTCTGCCCGCATTATGAGAAAGTGA
GCGGCGATTACGGACACCCTGTTTACATCGTACAGGAAAT
GCCGCCACAGAGCCCAGCAAACATCTATTACAAGGTGTGA
AAATGGACACGCTATTTTTTCCCGGACATTTTAACTCTAA
CCCCTCACATGCCCCTCGATGAACCCCCAGTTGGCGGCAT
CGATGCCTGAGCTCACCCTCGTTCTGCCCCCTCTTATTTT
ATTTTGTTGTTCTTGTTTATTTTACATTATTACTCTCAGT
ATAGATGTTGCTGATGGTGGAGTAACACTCCTGATTCGCT
GCTCTTGCACCTGCAAAAACGAGACAAACTAATAGACAAA
TGACAAAAATGGAAACCCTCCGGGGGGACTGATGTGCACT
ATAATGGATACTATAGTGTGTGTACGAGGAAGCGTGTGTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations