ZFIN ID: ZDB-TSCRIPT-090929-8541
Transcript Name: cdk20-201
Previous Names: cdk20-001, zgc:101530-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025834 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025834|OTTDARG00000020616|ZDB-GENE-041212-84 cdk20|OTTDARP00000021236 DKEYP-77F7.1-001 LG_ BX571687.17 Danio rerio protein_coding KNOWN, 1482 bp
AGAATCAATCTCCATGACAACTGCAAGTCGCCTCAGCGGA
GCATCGTGTTATTTCTCGCAATAAATGCTCATTCAGCTCG
CAAGTGATTGTTTTAACTTATCTTTTTATTTTGTCTTTGT
CAAATAACGGCGTGGAATATATGTCAGTGTGTTAATTGAG
ACATAAAACAGATTTTTATTTCTGTTTTGCTAGCCAGCTA
GTCGTGTAACTGTTAGCATCGGAATGGACCAGTATAGTAT
TCTTGGCCGGATTGGGGAAGGAGCTCACGGGATTGTTTTC
AAAGCCAAACACATTGAGACAGGAGAGACAGTGGCTTTGA
AAAAAGTGGCCCTGCGAAGACTTGAAGATGGCATCCCGAA
CCAGGCGTTAAGAGAAATTAAAGCCCTGCAAGAGATTGAG
GACAACCAATATGTTGTGAAGCTGAAGGACGTCTTCCCTC
ACGGCACAGGCTTTGTGCTGGTGTTCGAGTACATGTTATC
AGATCTGTCAGAAGTCATAAGGAATTCCCAGCGTCCTCTC
ACCGCATCCCAGGTCAAAAGTTATATGATGATGCTGCTGA
AAGGAGTGGCTTTCTGCCACGAGAACTCCATCATGCATAG
GGATCTGAAGCCTGCAAACCTTCTGATCAGCTCGACTGGT
CATCTGAAAATCGCTGACTTTGGTCTGGCAAGGCTTTTTT
CCAATGAAGGAGATCGTCTTTACAGTCACCAAGTGGCCAC
CAGATGGTACAGAGCACCAGAACTTTTATACGGTGCCCGA
AAATATGACGAAGGAGTTGATCTCTGGGCTGTGGGCTGCA
TTTTCGGAGAGCTTTTGAATAACTCTCCACTTTTCCCTGG
GGAGAATGACATTGAACAGTTGTGTTGTGTGCTCAGAGTG
CTGGGAACTCCCAACCAGAAAGTCTGGCCGGAGATAACCG
AACTACCAGACTACAACAAGATCACATTTAAAGAAAACCC
ACCCATTCCTTTGGAGGAGATCGTACCTGACACGTCACCA
CAAGCTGTAGACCTGCTGAAGAAGTTTCTGGTCTATCCAT
CCAAACAGAGGATCAGTGCTAGACAGGCTTTGCTCCATCC
ATATTTCTTCACGGATCCGCTCCCGGCTCATCATTCAGAG
CTGCCCATTCCTCAGCGTGGAGGAAAACACTCCAGACAGC
GCATGCAGCCGCCGCACGAGTTCACCGTCGATCGGCCTTT
ACACGAGAGCGTGGTGGACCCGAGTCTCATCCAGAAGCAT
GCCATGAGCTGTTCATGACACCCACATGAGCAGAAATGTC
AGGGTTTGTATTCAGTTTCACAGCAGAAAGCGGCACATTC
ACGGTCATACATGATCGTTTCGTTTCTAAAGGATTAAGGG
ACAAAATGATAAAAATGTTACAAGTTATTTATATTAAAGT
CTGCATGAACTGGAAGCTGGAAGCTTTTTTTTGGTATTGT
TATGCTGTTCCTATAGAAACAATATTAAATGTTAAAACAG
TG

cdk20 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cdk20-201 1482
cdk20-202 (1) 602
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdk20-201 Contained in:
[BAC] DKEYP-77F7 (1)
OTHER cdk20-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025834 (1)
  • Ensembl_Trans:ENSDART00000140098 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC086697 (1) 1507bp
    CITATIONS (2)