Transcript

cdk20-201

ID
ZDB-TSCRIPT-090929-8541
Name
cdk20-201
Previous Names
  • cdk20-001
  • zgc:101530-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025834 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025834|OTTDARG00000020616|ZDB-GENE-041212-84 cdk20|OTTDARP00000021236 DKEYP-77F7.1-001 LG_ BX571687.17 Danio rerio protein_coding KNOWN, 1482 bp
AGAATCAATCTCCATGACAACTGCAAGTCGCCTCAGCGGA
GCATCGTGTTATTTCTCGCAATAAATGCTCATTCAGCTCG
CAAGTGATTGTTTTAACTTATCTTTTTATTTTGTCTTTGT
CAAATAACGGCGTGGAATATATGTCAGTGTGTTAATTGAG
ACATAAAACAGATTTTTATTTCTGTTTTGCTAGCCAGCTA
GTCGTGTAACTGTTAGCATCGGAATGGACCAGTATAGTAT
TCTTGGCCGGATTGGGGAAGGAGCTCACGGGATTGTTTTC
AAAGCCAAACACATTGAGACAGGAGAGACAGTGGCTTTGA
AAAAAGTGGCCCTGCGAAGACTTGAAGATGGCATCCCGAA
CCAGGCGTTAAGAGAAATTAAAGCCCTGCAAGAGATTGAG
GACAACCAATATGTTGTGAAGCTGAAGGACGTCTTCCCTC
ACGGCACAGGCTTTGTGCTGGTGTTCGAGTACATGTTATC
AGATCTGTCAGAAGTCATAAGGAATTCCCAGCGTCCTCTC
ACCGCATCCCAGGTCAAAAGTTATATGATGATGCTGCTGA
AAGGAGTGGCTTTCTGCCACGAGAACTCCATCATGCATAG
GGATCTGAAGCCTGCAAACCTTCTGATCAGCTCGACTGGT
CATCTGAAAATCGCTGACTTTGGTCTGGCAAGGCTTTTTT
CCAATGAAGGAGATCGTCTTTACAGTCACCAAGTGGCCAC
CAGATGGTACAGAGCACCAGAACTTTTATACGGTGCCCGA
AAATATGACGAAGGAGTTGATCTCTGGGCTGTGGGCTGCA
TTTTCGGAGAGCTTTTGAATAACTCTCCACTTTTCCCTGG
GGAGAATGACATTGAACAGTTGTGTTGTGTGCTCAGAGTG
CTGGGAACTCCCAACCAGAAAGTCTGGCCGGAGATAACCG
AACTACCAGACTACAACAAGATCACATTTAAAGAAAACCC
ACCCATTCCTTTGGAGGAGATCGTACCTGACACGTCACCA
CAAGCTGTAGACCTGCTGAAGAAGTTTCTGGTCTATCCAT
CCAAACAGAGGATCAGTGCTAGACAGGCTTTGCTCCATCC
ATATTTCTTCACGGATCCGCTCCCGGCTCATCATTCAGAG
CTGCCCATTCCTCAGCGTGGAGGAAAACACTCCAGACAGC
GCATGCAGCCGCCGCACGAGTTCACCGTCGATCGGCCTTT
ACACGAGAGCGTGGTGGACCCGAGTCTCATCCAGAAGCAT
GCCATGAGCTGTTCATGACACCCACATGAGCAGAAATGTC
AGGGTTTGTATTCAGTTTCACAGCAGAAAGCGGCACATTC
ACGGTCATACATGATCGTTTCGTTTCTAAAGGATTAAGGG
ACAAAATGATAAAAATGTTACAAGTTATTTATATTAAAGT
CTGCATGAACTGGAAGCTGGAAGCTTTTTTTTGGTATTGT
TATGCTGTTCCTATAGAAACAATATTAAATGTTAAAACAG
TG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations