ZFIN ID: ZDB-TSCRIPT-090929-16116
Transcript Name: cdk20-202
Previous Names: cdk20-002, dkeyp-77f7.1-001-002, zgc:101530-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035499 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035499|OTTDARG00000020616|ZDB-GENE-041212-84 cdk20|OTTDARP00000028528 DKEYP-77F7.1-002 LG_ BX571687.17 Danio rerio protein_coding KNOWN, 602 bp
TCGCAATAAATGCTCATTCAGCTCGCAAGTGATTGTTTTA
ACTTATCTTTTTATTTTGTCTTTGTCAAATAACGGCGTGG
AATATATGTCAGTGTGTTAATTGAGACATAAAACAGATTT
TTATTTCTGTTTTGCTAGCCAGCTAGTCGTGTAACTGTTA
GCATCGGAATGGACCAGTATAGTATTCTTGGCCGGATTGG
GGAAGGAGCTCACGGGATTGTTTTCAAAGCCAAACACATT
GAGGTTGTGTCATGTATATCTTCATTTATTTTATGTTAAA
AGGCCGTTTTCTAATAAAAAGGCCTATGTGCACTTCATCT
GTTGATGTTTTCAGACAGGAGAGACAGTGGCTTTGAAAAA
AGTGGCCCTGCGAAGACTTGAAGATGGCATCCCGAACCAG
GCGTTAAGAGAAATTAAAGCCCTGCAAGAGATTGAGGACA
ACCAATATGTTGTGAAGCTGAAGGACGTCTTCCCTCACGG
CACAGGCTTTGTGCTGGTGTTCGAGTACATGTTATCAGAT
CTGTCAGAAGTCATAAGGAATTCCCAGCGTCCTCTCACCG
CATCCCAGGTCAAAAGTTATATGATGATGCTGCTGAAAGG
AG

cdk20 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cdk20-201 (1) 1482
cdk20-202 602
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdk20-202 Contained in:
[BAC] DKEYP-77F7 (1)
OTHER cdk20-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000035499 (1)
  • Ensembl_Trans:ENSDART00000148339 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BI890261 (1) 604bp
    CITATIONS (2)