header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16116
Transcript Name: cdk20-202
Previous Names: cdk20-002, dkeyp-77f7.1-001-002, zgc:101530-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035499 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035499|OTTDARG00000020616|ZDB-GENE-041212-84 cdk20|OTTDARP00000028528 DKEYP-77F7.1-002 LG_ BX571687.17 Danio rerio protein_coding KNOWN, 602 bp
TCGCAATAAATGCTCATTCAGCTCGCAAGTGATTGTTTTA
ACTTATCTTTTTATTTTGTCTTTGTCAAATAACGGCGTGG
AATATATGTCAGTGTGTTAATTGAGACATAAAACAGATTT
TTATTTCTGTTTTGCTAGCCAGCTAGTCGTGTAACTGTTA
GCATCGGAATGGACCAGTATAGTATTCTTGGCCGGATTGG
GGAAGGAGCTCACGGGATTGTTTTCAAAGCCAAACACATT
GAGGTTGTGTCATGTATATCTTCATTTATTTTATGTTAAA
AGGCCGTTTTCTAATAAAAAGGCCTATGTGCACTTCATCT
GTTGATGTTTTCAGACAGGAGAGACAGTGGCTTTGAAAAA
AGTGGCCCTGCGAAGACTTGAAGATGGCATCCCGAACCAG
GCGTTAAGAGAAATTAAAGCCCTGCAAGAGATTGAGGACA
ACCAATATGTTGTGAAGCTGAAGGACGTCTTCCCTCACGG
CACAGGCTTTGTGCTGGTGTTCGAGTACATGTTATCAGAT
CTGTCAGAAGTCATAAGGAATTCCCAGCGTCCTCTCACCG
CATCCCAGGTCAAAAGTTATATGATGATGCTGCTGAAAGG
AG

cdk20 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cdk20-201 (1)    Ensembl 1482
cdk20-202 602
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdk20-202 Contained in:
[BAC] DKEYP-77F7 (1)

Genome Resources: Vega_Trans:OTTDART00000035499 (1),  Ensembl_Trans:ENSDART00000148339 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BI890261 (1) 604 bp
CITATIONS (2)