Transcript

cdk20-202

ID
ZDB-TSCRIPT-090929-16116
Name
cdk20-202
Previous Names
  • cdk20-002
  • dkeyp-77f7.1-001-002
  • zgc:101530-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035499 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035499|OTTDARG00000020616|ZDB-GENE-041212-84 cdk20|OTTDARP00000028528 DKEYP-77F7.1-002 LG_ BX571687.17 Danio rerio protein_coding KNOWN, 602 bp
TCGCAATAAATGCTCATTCAGCTCGCAAGTGATTGTTTTA
ACTTATCTTTTTATTTTGTCTTTGTCAAATAACGGCGTGG
AATATATGTCAGTGTGTTAATTGAGACATAAAACAGATTT
TTATTTCTGTTTTGCTAGCCAGCTAGTCGTGTAACTGTTA
GCATCGGAATGGACCAGTATAGTATTCTTGGCCGGATTGG
GGAAGGAGCTCACGGGATTGTTTTCAAAGCCAAACACATT
GAGGTTGTGTCATGTATATCTTCATTTATTTTATGTTAAA
AGGCCGTTTTCTAATAAAAAGGCCTATGTGCACTTCATCT
GTTGATGTTTTCAGACAGGAGAGACAGTGGCTTTGAAAAA
AGTGGCCCTGCGAAGACTTGAAGATGGCATCCCGAACCAG
GCGTTAAGAGAAATTAAAGCCCTGCAAGAGATTGAGGACA
ACCAATATGTTGTGAAGCTGAAGGACGTCTTCCCTCACGG
CACAGGCTTTGTGCTGGTGTTCGAGTACATGTTATCAGAT
CTGTCAGAAGTCATAAGGAATTCCCAGCGTCCTCTCACCG
CATCCCAGGTCAAAAGTTATATGATGATGCTGCTGAAAGG
AG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations