Transcript

myo6b-203

ID
ZDB-TSCRIPT-090929-8421
Name
myo6b-203
Previous Names
  • myo6b-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025703 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025703|OTTDARG00000020515|ZDB-GENE-030318-3 myo6b|OTTDARP00000021128 myo6b-002 LG_none BX649242.6,BX571720.6 Danio rerio protein_coding KNOWN, 3997 bp
AGAGAGGAACGACAGCGGCTTTGGAAAAGGGAATATTCAG
CATCGAGGAGGGAATCTGTCACCGCTAACCGGGACAGTCT
GTCGCTCATCTGTCCTCAAAAGAAGCTGCTCTTACCGGAT
TTACACACAATAGCTGTGGAGTAATTGTGGGGTGCAATGG
ATGATGGGAAGCCTGTGTGGGCGCCCCACCCAACCGACGG
GTTTCAACTGGGCATGATAGTGGACATCGGTGCAGATGCG
CTGACCATTGAGCCCCTTCATCAGAGAGGAAAGACGTTCC
TGGCTCCCATCAGTCAAGTGTTTCCCGCTGAAGACGATGT
CAACAAACATGTTGAAGACAACTGTTCTCTTATGTATTTG
AATGAGGCCACTCTCCTGAACAACATCCGCATCCGTTACA
GCAAAGACATGATCTATACGTTTGTGGCTAACATCCTCAT
AGCTGTGAACCCGTATTTCGACATCCCTAAACTCTACTCT
CCAGAGTCTATTAAGAGCTATCAGGGACGCTCTTTGGGGA
CTCTTCCCCCTCATGTCTATGCTATCGCGGATAAAGCCTA
TAGAGACATGAGGGTTCTGAAGATGAGCCAGTCCATCATT
GTGTCTGGTGAATCAGGAGCTGGGAAAACAGAAAACACAA
AGTTTGTTCTCAGGTATTTAACCACATCTTACGGCACAGG
CCAAGATATAGATGAGAGGATTGTTGAAGCCAACCCCTTG
CTTGAAGCTTTTGGAAATGCAAAGACGGTCAGGAACAACA
ACAGCAGCCGCTTTGGAAAGTTTGTGGAAATTCATTTTAA
TGAGAAGAATGCAGTTGTGGGCGGTTTTGTCTCTCACTAT
CTGCTGGAGAAGTCTCGGATTTGCATGCAGAGTCAAGAAG
AGCGAAACTATCATATATTTTATAGACTGTGCGCAGGGGC
GTCAGAGGACATCAGGAACATGCTCCATCTCAACTCCCCC
GACAGCTTCCGGTATTTGAATCGTGGCTGCACCCGATACT
TTGCAAACAAGGACTCAGATAAACAGATCATGCAAAACAG
GAAAAGTCCTGAGGACCATAAGCATGGGAAAGTAGGTGCG
TTGAAGGACCCTCTGCTAGATGACTTGGGAGACTTCAACA
GGATGGTGGTGGCCATGAAGAAGATCGGCTTGGATGACAC
CGAGAAGCTCAATCTCTTCAGAGTGGTGGCCGGCGTTCTT
CATCTCGGCAATATCGACTTTGAAGAGACAGGAAGCACCT
CTGGTGGCTGCATTTTGAAGAACCAGTCAAGTCAGACTCT
GGAGTATTGCGCTGATCTCCTGGGCCTCGACCAGGACGAC
CTGAGAGTGAGCCTCACCACCAGGGTCATGCTCACCACTG
CAGGGGGCGCTAAAGGCACTGTCATCAAGGTGCCTCTGAA
GGTGGAACAGGCCAACAATGCCCGTGATGCCCTCGCCAAA
GCCGTTTACAGCCGGCTCTTTGATCATGTGGTCAAACGGG
TCAACCAGTGCTTCCCCTTTGATACGTCCTCCAACTTCAT
CGGCGTGCTGGACATTGCTGGCTTTGAGTATTTCGAGCAC
AACAGCTTTGAGCAGTTCTGCATCAACTATTGTAATGAAA
AGCTGCAGCAGTTTTTTAATGAACGCATACTGAAAGAGGA
GCAAGAGCTGTATCAGAGAGAAGGCCTGGGAGTGAATGAA
GTTCATTATGTTGATAATCAGGACTGCATAGATCTGGTCG
AGGCAAAGCTAGTGGGTGTCTTGGATATTTTGGATGAGGA
GAACCGTCTTCCGCAGCCCAGCGATCAGCACTTTGCGGAG
GCAGTTCACAGCAAGCACAAAGATCACTTCCGTCTCACAG
TACCCAGGAAGTCGAAGCTTACAATCCACAGGAATTTGAG
AGATGATGAAGGTTTCATCATAAGACATTTTGCTGGCGCT
GTGTGCTATGAGACTACCCAGTTTGTGGAGAAGAATAATG
ACGCCCTCCACATGTCTTTGGAGAGCCTGGTGTGTGAGTC
GAAGGACAAGTTTGTCCGGGATCTTTTTGAGAACAACTCC
AATTCCAAGGACTCAAAGCAGAAGGCTGGCAAACTCAGCT
TTATCAGTGTGGGAAACAAATTCAAGACCCAACTAAACCT
TCTACTGGAAAAGCTCCGCAGTACAGGCTCAAGTTTCATT
CGTTGTGTGAAGCCTAATTTGAAGATGGTGAGCCACCAGT
TTGAAGGAGCTCAGATTCTGTCTCAGCTGCAGTGCTCAGG
CATGGTATCAGTGCTGGACCTGATGCAGGGGGGCTTCCCT
TCCCGAGCACCGTTTCATGAGCTTTACAATATGTACAAGC
AGTACATGCCCAACAAACTCACAAGGCTCGATCCACGACT
CTTCTGCAAAGCTCTGTTTAAAGCGCTGGGCCTCAACGAG
AACGATTACAAGTTTGGATTGACCAGAGTTTTCTTCCGCC
CTGGGAAGTTCGCAGAGTTCGACCAGATCATGAAGTCTGA
TCCGGACCACCTGGCCGAGCTTGTAAAACGGGTCAATAAG
TGGCTGGTGTGCAGCCGCTGGAAGAAAGTCCAGTGGTGCA
CACTGTCAGTTATTAAACTGAGGAACAAAATGAGCTACAG
GGCAAGCGCCTGCATTAGGATTCAGAAGACGGTTCGCATG
TGGCTGTGCAGAAGAAGACACAAGCCTCGTGTCGATGGCC
TGGTGAAGGTGAAAAATTTGAGGAAGAGGATGGAGAGGTT
CAACGAGGCTGTGAACGGACTCAAGGAGGGTAAAGCGGAA
ATGAGCAAGCAGATCGAGGAACTGGCCGCCTCCACCGACG
CTCTCATGGCCAAGATCAAGACCACTGTAATGAGCCGCAA
GGAGATCGAGCAGGAGTATGAGGGCCTGGTGAAACGCTCC
GAGCAGCTGCTCTCCTCAATGCAGAAGAAGAAGCAGGAGC
AGGAGGAGACGGAGAGACTCAAGCACATCCAGGAGGAGAT
GGAGAAAGAGCGCAAGAGACACGAAGAGGAGGAGCAGTTA
CGCAAACAGGAGGAAGAAGACCGCCGCATGAAATCTGAGA
TGGAGCAGAAGAGGAAGCAGGAGGAAGAGGAGAGGAAGAA
AAGAGAAGAGGAAGAGCGAGTCCTGCAGGCCGAACTTGAG
ATGCAGCTGGCATTGGACCGGGAGGAAGAGACTCAGAGAC
AGACCATTCTGGAGCAGGAGAGGAGGGACAGAGAGTTGGC
CATGAGGATCGCCCAGAACGAGGCAGAACTCATCCAGGAT
GAAGCCCAGATGGATCCCATCTTGCGCAGGGGTGCGCAGG
TGCAGGCCAACAAGGTGGCAGCTGGGGTGAAGAAGTACGA
CCTGAGCAAGTGGAAGTACGCTGAGCTGCGAGACGCCATC
AACACCTCCTGTGATATAGAATTGTTGGCAGCTTGCCGAG
AAGAATTTCACCGTCGTCTGAAGGTCTACCATGCCTGGAA
ATCAAAGAACAAGAAGCGAAATACAGACACAGAGATGAGG
GCTCCAAAATCGGTCACCGACTACGCCCAGCAAAACCCTG
CTCCACCTGTCCCAGCCCGGCAACAAGAGATCGCGATGAA
CCGACAGCAGCGTTACTTCCGCATTCCCTTCATCCGGCCC
GCAGACCAGTACAAAGACCCCCAGAACAAGAAGAAAGGCT
GGTGGTACGCTCACTTTGATGGACCCTGGATCGCTAGGCA
GATGGAGCTTCATCCAGACAAGCAGCCGATCCTCTTGGTT
GCAGGTAAAGATGACATGGAGATGTGCGAGTTGAGTCTGG
AGGAGACCGGCCTCACACGAAAACGTGGAGCCGAGATCCT
GCCCCGGCAGTTTGAGGAGATCTGGGAGCGCTGCGGTGGA
ATCCAATACTTGAAGAATGCTATTGAAAGCAAGCAGGCCC
GTCCCACCTACGCCACCGCCATGCTTCAGAATCTCCTCAA
GTGAACATCACACATTTCTCTTATTGGTTCACTTTATCTA
TGCACATTTAGATTAAAAGTTGTGCTGCTAGAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations