Transcript

myo6b-202

ID
ZDB-TSCRIPT-090929-8420
Name
myo6b-202
Previous Names
  • myo6b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025702 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025702|OTTDARG00000020515|ZDB-GENE-030318-3 myo6b|OTTDARP00000021127 myo6b-001 LG_none BX649242.6,BX571720.6 Danio rerio protein_coding KNOWN, 3888 bp
GTGCAATGGATGATGGGAAGCCTGTGTGGGCGCCCCACCC
AACCGACGGGTTTCAACTGGGCATGATAGTGGACATCGGT
GCAGATGCGCTGACCATTGAGCCCCTTCATCAGAGAGGAA
AGACGTTCCTGGCTCCCATCAGTCAAGTGTTTCCCGCTGA
AGACGATGTCAACAAACATGTTGAAGACAACTGTTCTCTT
ATGTATTTGAATGAGGCCACTCTCCTGAACAACATCCGCA
TCCGTTACAGCAAAGACATGATCTATACGTTTGTGGCTAA
CATCCTCATAGCTGTGAACCCGTATTTCGACATCCCTAAA
CTCTACTCTCCAGAGTCTATTAAGAGCTATCAGGGACGCT
CTTTGGGGACTCTTCCCCCTCATGTCTATGCTATCGCGGA
TAAAGCCTATAGAGACATGAGGGTTCTGAAGATGAGCCAG
TCCATCATTGTGTCTGGTGAATCAGGAGCTGGGAAAACAG
AAAACACAAAGTTTGTTCTCAGGTATTTAACCACATCTTA
CGGCACAGGCCAAGATATAGATGAGAGGATTGTTGAAGCC
AACCCCTTGCTTGAAGCTTTTGGAAATGCAAAGACGGTCA
GGAACAACAACAGCAGCCGCTTTGGAAAGTTTGTGGAAAT
TCATTTTAATGAGAAGAATGCAGTTGTGGGCGGTTTTGTC
TCTCACTATCTGCTGGAGAAGTCTCGGATTTGCATGCAGA
GTCAAGAAGAGCGAAACTATCATATATTTTATAGACTGTG
CGCAGGGGCGTCAGAGGACATCAGGAACATGCTCCATCTC
AACTCCCCCGACAGCTTCCGGTATTTGAATCGTGGCTGCA
CCCGATACTTTGCAAACAAGGACTCAGATAAACAGATCAT
GCAAAACAGGAAAAGTCCTGAGGACCATAAGCATGGGAAA
GTAGGTGCGTTGAAGGACCCTCTGCTAGATGACTTGGGAG
ACTTCAACAGGATGGTGGTGGCCATGAAGAAGATCGGCTT
GGATGACACCGAGAAGCTCAATCTCTTCAGAGTGGTGGCC
GGCGTTCTTCATCTCGGCAATATCGACTTTGAAGAGACAG
GAAGCACCTCTGGTGGCTGCATTTTGAAGAACCAGTCAAG
TCAGACTCTGGAGTATTGCGCTGATCTCCTGGGCCTCGAC
CAGGACGACCTGAGAGTGAGCCTCACCACCAGGGTCATGC
TCACCACTGCAGGGGGCGCTAAAGGCACTGTCATCAAGGT
GCCTCTGAAGGTGGAACAGGCCAACAATGCCCGTGATGCC
CTCGCCAAAGCCGTTTACAGCCGGCTCTTTGATCATGTGG
TCAAACGGGTCAACCAGTGCTTCCCCTTTGATACGTCCTC
CAACTTCATCGGCGTGCTGGACATTGCTGGCTTTGAGTAT
TTCGAGCACAACAGCTTTGAGCAGTTCTGCATCAACTATT
GTAATGAAAAGCTGCAGCAGTTTTTTAATGAACGCATACT
GAAAGAGGAGCAAGAGCTGTATCAGAGAGAAGGCCTGGGA
GTGAATGAAGTTCATTATGTTGATAATCAGGACTGCATAG
ATCTGGTCGAGGCAAAGCTAGTGGGTGTCTTGGATATTTT
GGATGAGGAGAACCGTCTTCCGCAGCCCAGCGATCAGCAC
TTTGCGGAGGCAGTTCACAGCAAGCACAAAGATCACTTCC
GTCTCACAGTACCCAGGAAGTCGAAGCTTACAATCCACAG
GAATTTGAGAGATGATGAAGGTTTCATCATAAGACATTTT
GCTGGCGCTGTGTGCTATGAGACTACCCAGTTTGTGGAGA
AGAATAATGACGCCCTCCACATGTCTTTGGAGAGCCTGGT
GTGTGAGTCGAAGGACAAGTTTGTCCGGGATCTTTTTGAG
AACAACTCCAATTCCAAGGACTCAAAGCAGAAGGCTGGCA
AACTCAGCTTTATCAGTGTGGGAAACAAATTCAAGACCCA
ACTAAACCTTCTACTGGAAAAGCTCCGCAGTACAGGCTCA
AGTTTCATTCGTTGTGTGAAGCCTAATTTGAAGATGGTGA
GCCACCAGTTTGAAGGAGCTCAGATTCTGTCTCAGCTGCA
GTGCTCAGGCATGGTATCAGTGCTGGACCTGATGCAGGGG
GGCTTCCCTTCCCGAGCACCGTTTCATGAGCTTTACAATA
TGTACAAGCAGTACATGCCCAACAAACTCACAAGGCTCGA
TCCACGACTCTTCTGCAAAGCTCTGTTTAAAGCGCTGGGC
CTCAACGAGAACGATTACAAGTTTGGATTGACCAGAGTTT
TCTTCCGCCCTGGGAAGTTCGCAGAGTTCGACCAGATCAT
GAAGTCTGATCCGGACCACCTGGCCGAGCTTGTAAAACGG
GTCAATAAGTGGCTGGTGTGCAGCCGCTGGAAGAAAGTCC
AGTGGTGCACACTGTCAGTTATTAAACTGAGGAACAAAAT
GAGCTACAGGGCAAGCGCCTGCATTAGGATTCAGAAGACG
GTTCGCATGTGGCTGTGCAGAAGAAGACACAAGCCTCGTG
TCGATGGCCTGGTGAAGGTGAAAAATTTGAGGAAGAGGAT
GGAGAGGTTCAACGAGGCTGTGAACGGACTCAAGGAGGGT
AAAGCGGAAATGAGCAAGCAGATCGAGGAACTGGCCGCCT
CCACCGACGCTCTCATGGCCAAGATCAAGACCACTGTAAT
GAGCCGCAAGGAGATCGAGCAGGAGTATGAGGGCCTGGTG
AAACGCTCCGAGCAGCTGCTCTCCTCAATGCAGAAGAAGA
AGCAGGAGCAGGAGGAGACGGAGAGACTCAAGCACATCCA
GGAGGAGATGGAGAAAGAGCGCAAGAGACACGAAGAGGAG
GAGCAGTTACGCAAACAGGAGGAAGAAGACCGCCGCATGA
AATCTGAGATGGAGCAGAAGAGGAAGCAGGAGGAAGAGGA
GAGGAAGAAAAGAGAAGAGGAAGAGCGAGTCCTGCAGGCC
GAACTTGAGATGCAGCTGGCATTGGACCGGGAGGAAGAGA
CTCAGAGACAGACCATTCTGGAGCAGGAGAGGAGGGACAG
AGAGTTGGCCATGAGGATCGCCCAGAACGAGGCAGAACTC
ATCCAGGATGAAGCCCAGATGGATCCCATCTTGCGCAGAG
ATGCTACCACAGGTGTTTGGTTCTTCACAGAGATGGGTGC
GCAGGTGCAGGCCAACAAGGTGGCAGCTGGGGTGAAGAAG
TACGACCTGAGCAAGTGGAAGTACGCTGAGCTGCGAGACG
CCATCAACACCTCCTGTGATATAGAATTGTTGGCAGCTTG
CCGAGAAGAATTTCACCGTCGTCTGAAGGTCTACCATGCC
TGGAAATCAAAGAACAAGAAGCGAAATACAGACACAGAGA
TGAGGGCTCCAAAATCGGTCACCGACTACGCCCAGCAAAA
CCCTGCTCCACCTGTCCCAGCCCGGCAACAAGAGATCGCG
ATGAACCGACAGCAGCGTTACTTCCGCATTCCCTTCATCC
GGCCCGCAGACCAGTACAAAGACCCCCAGAACAAGAAGAA
AGGCTGGTGGTACGCTCACTTTGATGGACCCTGGATCGCT
AGGCAGATGGAGCTTCATCCAGACAAGCAGCCGATCCTCT
TGGTTGCAGGTAAAGATGACATGGAGATGTGCGAGTTGAG
TCTGGAGGAGACCGGCCTCACACGAAAACGTGGAGCCGAG
ATCCTGCCCCGGCAGTTTGAGGAGATCTGGGAGCGCTGCG
GTGGAATCCAATACTTGAAGAATGCTATTGAAAGCAAGCA
GGCCCGTCCCACCTACGCCACCGCCATGCTTCAGAATCTC
CTCAAGTGAACATCACACATTTCTCTTATTGGTTCACTTT
ATCTATGCACATTTAGATTAAAAGTTGTGCTGCTAGAAAA
AAGGGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations