ZFIN ID: ZDB-TSCRIPT-090929-8298
Transcript Name: psma5-202
Previous Name: psma5-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025568 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025568|OTTDARG00000020445|ZDB-GENE-040625-96 psma5|OTTDARP00000021023 psma5-002 LG_ BX248230.21 Danio rerio protein_coding KNOWN, 861 bp
CCAATGCAAACATCGCGTTGCTACATAGCAAGCAAGCAAG
CGAGCTGTTGTGCTTTATGCTACTTCACTACATTTGAAGT
TGGCTAATTCAGATCTCATTTAACACTTCTCTTTGTTTTT
ACATAGATTTGCGTTTCAACATGTTCCTGACAAGATCAGA
ATATGACAGAGGAGTAAACACTTTCTCACCAGAAGGAAGG
CTTTTTCAGGTTGAATATGCCATTGAAGCCATCAAGTTGG
GGTCCACAGCCATTGGCATTCAGACATCAGAGGGAGTTTG
TCTTGCTGTGGAGAAGAGAATAACCTCTCCTCTGATGGAG
CCCAGCAGCATTGAAAAGATTGTAGAGATCGACTCTCACA
TTGGCTGTGCCATGAGTGGCTTGATAGCTGATGCCAAAAC
TCTTATTGACAAAGCAAGAGTAGAAACACAGAACCATTGG
TTTACCTACAATGAGACGATGACTGTGGAGAGCGTAACAC
AAGCCGTTTCTAATCTTGCTCTGCAGTTTGGAGAGGAGGA
TGCTGACCCCGGCGCTATGAGCCGTCCTTTTGGTGTCGCT
TTGCTTTTCGGAGGTGTGGATGAGAAAGGACCTCAGCTAT
ACCACATGGATCCTTCAGGCACTTTTGTCCAGTGTGACGC
GAGAGCAATCGGCTCAGCATCTGAAGGCGCTCAGAGCTCT
CTTCAAGAGGTTTACCACAAGTCTATGACGTTAAAGGATG
CCATTAAGTCTTCTCTCACTATCCTGAAACAAGTGATGGA
GGAGAAACTCAATGCCACCAATATTGAGCTTGCCACTGTA
GAGCCGGGCAAAACCTTTCACATGTACACAAAAGAAGAGC
TGGAGGATGTCATCAAGGATA

psma5 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA psma5-201 (1)    Ensembl 1131
psma5-202 861
psma5-203 (1)    Ensembl 761
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
psma5-202 Contained in:
[BAC] CH211-213O11 (1)

Genome Resources: Vega_Trans:OTTDART00000025568 (1),  Ensembl_Trans:ENSDART00000141477 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CO811904 (1) 906 bp
GenBank:CN833174 (1) 879 bp
GenBank:CT699855 (1) 822 bp
GenBank:DV588120 (1) 794 bp
GenBank:CT625255 (1) 725 bp
CITATIONS (2)