header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8297
Transcript Name: psma5-201
Previous Name: psma5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025567 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025567|OTTDARG00000020445|ZDB-GENE-040625-96 psma5|OTTDARP00000021022 psma5-001 LG_ BX248230.21 Danio rerio protein_coding KNOWN, 1131 bp
CTGATGAATTCAGCGGGGTAGGAACCCAAAGTTGACTTGC
AGTGTTTTTTGTCGAGCGGGGATGAATGAACACTTCCTGT
ACTGTTGAAACTAGCAAACTCACCCTCCACTGCAGAAGAT
TTGCGTTTCAACATGTTCCTGACAAGATCAGAATATGACA
GAGGAGTAAACACTTTCTCACCAGAAGGAAGGCTTTTTCA
GGTTGAATATGCCATTGAAGCCATCAAGTTGGGGTCCACA
GCCATTGGCATTCAGACATCAGAGGGAGTTTGTCTTGCTG
TGGAGAAGAGAATAACCTCTCCTCTGATGGAGCCCAGCAG
CATTGAAAAGATTGTAGAGATCGACTCTCACATTGGCTGT
GCCATGAGTGGCTTGATAGCTGATGCCAAAACTCTTATTG
ACAAAGCAAGAGTAGAAACACAGAACCATTGGTTTACCTA
CAATGAGACGATGACTGTGGAGAGCGTAACACAAGCCGTT
TCTAATCTTGCTCTGCAGTTTGGAGAGGAGGATGCTGACC
CCGGCGCTATGAGCCGTCCTTTTGGTGTCGCTTTGCTTTT
CGGAGGTGTGGATGAGAAAGGACCTCAGCTATACCACATG
GATCCTTCAGGCACTTTTGTCCAGTGTGACGCGAGAGCAA
TCGGCTCAGCATCTGAAGGCGCTCAGAGCTCTCTTCAAGA
GGTTTACCACAAGTCTATGACGTTAAAGGATGCCATTAAG
TCTTCTCTCACTATCCTGAAACAAGTGATGGAGGAGAAAC
TCAATGCCACCAATATTGAGCTTGCCACTGTAGAGCCGGG
CAAAACCTTTCACATGTACACAAAAGAAGAGCTGGAGGAT
GTCATCAAGGATATCTAAACGTGCTAAGCATAACAGATGT
TCAATATGAAAAGTCCAGTGTAATTTTTGTGTGAATCATC
ACACAGCAGAATGGATACATAATACTCTGACTGCATTGTA
CGGTTTGCCTGTTCAGACGGGAATCGAATCTTTATACTTT
TCTTTTTCCTTCTGTCAGTCCCAAAATTTCTATAGTTCTG
TACAAGCACAGGACAGCAGATCTTGTCATTGAATTAAATG
GGGGGGTTCTTTTTGTTACCAATCACTGCGTTAATAAACT
GTTGTTGAAAA

psma5 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA psma5-201 1131
psma5-202 (1)    Ensembl 861
psma5-203 (1)    Ensembl 761
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
psma5-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000025567 (1),  Ensembl_Trans:ENSDART00000020655 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AY398400 (1) 1104 bp
GenBank:BC071495 (1) 1102 bp
GenBank:CO960640 (1) 844 bp
CITATIONS (2)