ZFIN ID: ZDB-TSCRIPT-090929-8100
Transcript Name: rpl34-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025352 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025352|OTTDARG00000020306|ZDB-GENE-040426-1033 rpl34|no_translation rpl34-003 LG_ BX088542.7 Danio rerio protein_coding KNOWN, 671 bp
AGCGTTTGCGCTTAAAACTGGACTCGGGCTATCCGTCGTC
ATCTGCCGTTGTTAAAGATTAAATTTACGATATACAGAGT
TATGTAAATAGTTTACAGTCTAACAGAAAGATACCGTTGC
AACATTAAGTAATTATGTTGCCTAAAATAGAGTTTTGGGA
CTTCAAGTTGACGCTGTGACCGCTGAAGTTAAAAGGAACT
CAGCAGGCTGTGGATGTACTAGTATTAGTATAACAATTGT
GAACGTATAAATTAATAAATCATTGTAAGTTTAACGCAGC
CAAGCATGAACTTGAACACGGTTGTTTTTTTCAGGTCAAG
ATGGTGCAGCGCCTGACATATCGCCGTAGACTTTCCTACA
ACACTGCGTCAAACAAGACCAGGCTGTGAGTGCGGTTGCT
TGACGTAAAAGATTTTTATGTAACGTTACCAAGTGATAAG
TCACTATACCGCGTTCAATTCAAGCTTCAAGTATTGCACT
TAACGGCTGCTTTCGGTCGCAGGTCCCGTACTCCAGGTAA
CCGCATTGTGTACCTGTACACGAAGAAGACAGGCAAGTCA
CCTAAGTCAGCTTGCGGAATTTGCCCCGGCAGACTGCGTG
GAATTCGTGCTGTGAGACCCCAAGTTCTTATGAGGCTTTC
AAAAACCAAGAAGCATGTCAGCCGAGCCTAT

rpl34 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rpl34-003 671
rpl34-004 (1) 853
mRNA rpl34-201 (1) 430
rpl34-202 (1) 655
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rpl34-003 Contained in:
OTHER rpl34-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025352 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT601761 (1) 670bp
    CITATIONS (1)