ZFIN ID: ZDB-TSCRIPT-090929-8098
Transcript Name: rpl34-201
Previous Name: rpl34-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025350 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025350|OTTDARG00000020306|ZDB-GENE-040426-1033 rpl34|OTTDARP00000020858 rpl34-001 LG_ BX088542.7 Danio rerio protein_coding KNOWN, 430 bp
CTTTTCCGTCTGGTGTGTTAAAAGGTCAAGATGGTGCAGC
GCCTGACATATCGCCGTAGACTTTCCTACAACACTGCGTC
AAACAAGACCAGGCTGTCCCGTACTCCAGGTAACCGCATT
GTGTACCTGTACACGAAGAAGACAGGCAAGTCACCTAAGT
CAGCTTGCGGAATTTGCCCCGGCAGACTGCGTGGAATTCG
TGCTGTGAGACCCCAAGTTCTTATGAGGCTTTCAAAAACC
AAGAAGCATGTCAGCCGAGCCTATGGTGGTTCCATGTGTG
CCAAATGTGTACGAGACAGGATCAAGCGGGCTTTCCTCAT
TGAGGAACAGAAGATAGTTGTCAAAGTCCTGAAGGCACAG
GCACAGACCCAGAAGTCGAAGTAGTAGTACAGAAGTCATT
TTGCATTGAATAAAACATTTGGAAACCTTT

rpl34 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rpl34-003 (1) 671
rpl34-004 (1) 853
mRNA rpl34-201 430
rpl34-202 (1) 655
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rpl34-201 Contained in:
OTHER rpl34-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025350 (1)
  • Ensembl_Trans:ENSDART00000040771 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC049023 (1) 528bp
    GenBank:BC062280 (1) 439bp
    CITATIONS (2)