ZFIN ID: ZDB-TSCRIPT-090929-8099
Transcript Name: rpl34-202
Previous Name: rpl34-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025351 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025351|OTTDARG00000020306|ZDB-GENE-040426-1033 rpl34|OTTDARP00000020859 rpl34-002 LG_ BX088542.7 Danio rerio protein_coding KNOWN, 655 bp
CTTTTCCGTCTGGTGTGTTAAAAGGTATGGCGTGTAGCGT
TTGCGCTTAAAACTGGACTCGGGCTATCCGTCGTCATCTG
CCGTTGTTAAAGATTAAATTTACGATATACAGAGTTATGT
AAATAGTTTACAGTCTAACAGAAAGATACCGTTGCAACAT
TAAGTAATTATGTTGCCTAAAATAGAGTTTTGGGACTTCA
AGTTGACGCTGTGACCGCTGAAGTTAAAAGGAACTCAGCA
GGCTGTGGATGTCAAGATGGTGCAGCGCCTGACATATCGC
CGTAGACTTTCCTACAACACTGCGTCAAACAAGACCAGGC
TGTCCCGTACTCCAGGTAACCGCATTGTGTACCTGTACAC
GAAGAAGACAGGCAAGTCACCTAAGTCAGCTTGCGGAATT
TGCCCCGGCAGACTGCGTGGAATTCGTGCTGTGAGACCCC
AAGTTCTTATGAGGCTTTCAAAAACCAAGAAGCATGTCAG
CCGAGCCTATGGTGGTTCCATGTGTGCCAAATGTGTACGA
GACAGGATCAAGCGGGCTTTCCTCATTGAGGAACAGAAGA
TAGTTGTCAAAGTCCTGAAGGCACAGGCACAGACCCAGAA
GTCGAAGTAGTAGTACAGAAGTCATTTTGCATTGAATAAA
ACATTTGGAAACCTT

rpl34 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rpl34-003 (1) 671
rpl34-004 (1) 853
mRNA rpl34-201 (1) 430
rpl34-202 655
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rpl34-202 Contained in:
OTHER rpl34-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025351 (1)
  • Ensembl_Trans:ENSDART00000123520 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK400256 (1) 693bp
    GenBank:CT597755 (1) 575bp
    GenBank:CT597756 (1) 565bp
    GenBank:CB362935 (1) 535bp
    CITATIONS (2)