ZFIN ID: ZDB-TSCRIPT-090929-8093
Transcript Name: axin2-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025344 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025344|OTTDARG00000020301|ZDB-GENE-000403-2 axin2|no_translation axin2-002 LG_ BX088708.14 Danio rerio protein_coding KNOWN, 1429 bp
ATGCTATTGCTTTGATGTGCTGTTTACCGACTTTGAAGTC
ATGTGTCGCTGTGAAATGAAGTATTTCTGATAGACGCTAC
AATAAAAAGCATAGAGAAGCTCCCCTGCTGATTTAAGAGA
GAGAGGAGATTACAGCTGAGCTTCACACTGAAGGCTTTGC
TGCTGGAGCTGCAAGAGCCATGAATAGGACACTAACAGAT
CCTATGGTCAGTAGCTTCAGAGAAGATGACCCACGTCCAC
CGGTCCCAGGGGAAGAGGGTGAGACGACATGCCACCATCC
CAGCAAACTGGCCATGATGAGACCGAAGGATCCTGTCAAG
ACCATTATGGCTGATCTTCGTTGTTCCACGGCCAGGAGGG
ATGAGGATGGACTTGGGGAACCTGAGGGCAGCGCATCCCC
GGACTCCCCTCTTGCCCGGTGGACCAAATCTTTGCATTTT
CTTCTCGGGGACCAGGATGGTGCTCAACTTTTCCGGGCAT
ACCTTGAACGCGAGAAATGTGTGGACACTTTAGATTTTTG
GTTTGCCTGCAATGGTTTCAGACAAATGGACCTCAAGGAT
ACCAAAACGCACAGAGTTGCCAAAGCCATTTACAAGCGGT
ATATTGAGAACAACAGCATTGTGGCCAAGCAGCTTAAACC
TGCCACTAAGACCTTTATTAGGGATAATATTAAGCGTCAG
CAGATTGACTCTGCAATGTTTGATCAGGCTCAAATGGAGA
TCCAGACGGCTATGGAGGAGAATGCCTATCAGATGTTTTT
GACCTCGGACATATACCTCGAGTATGTCAGAACTGGGTGC
GAGAACCCCAGTCATGTGAATCCCAATGGTCTAGGAGGTC
TAAAGCTGGTGTGCGGATACTTGCCAACTTTAAATGAAGA
AGAAGAGTGGAGTTGTAATGACTTTAAAGCCAAAGCTTTG
GCCACTGTAGTGGGTCTGTCTGCCAAAACACTACGGTCAC
CACCTCTTCGTGCTGTGGAAGCACTGGAGAAAGGCTACAG
GTCCTACAGACGCAGTGACCCCGGAAATCCTAATCGTTTT
ACGTCCGGTTATAGTTTTGCCCCTGCCACGAGTGCCAATG
ACAGTGAAGTTTCTAGTGATGCACTGACGGATGACTCCAT
GTCAATGACAGACAGTAGTGTGTAAGTGTGTGCATGACCT
ATATTAACCAAAGTAATAATAAAACACATCTTTCACAGCT
GCCTACCTGTGTAAAAATATAGACTGTTCTCAAACATCAG
CATCTTTTGTAGTGCTTTTAGTAGACATTACAATTAAGCA
GTTAGTCATGGTTGGTAATGAGAAGTTACAGATTCAGACG
ATACATTGACATTTAAATATGTTTATGACATGTAAGTAAT
GCACTGCTGGAGGGAAAAGGGGCTGAGCTATCGAAATAAA
GTGGACCCAAGAGAAGAATCCTCAGATAA

axin2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA axin2-002 1429
mRNA axin2-202 (1) 3515
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
axin2-002 Contained in:
OTHER axin2-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025344 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC095606 (1) 1462bp
    CITATIONS (1)