ZFIN ID: ZDB-TSCRIPT-090929-8092
Transcript Name: axin2-202
Previous Name: axin2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025343 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025343|OTTDARG00000020301|ZDB-GENE-000403-2 axin2|OTTDARP00000020854 axin2-001 LG_ BX088708.14 Danio rerio protein_coding KNOWN, 3515 bp
TGCGCTCTTTGATGTCCGCTCTTAAACCCTGAGCTCAGTC
CACACTGGAATAAGAGACCAGAGCACATTCAACACACTAT
ACAGGGATCCAGTGTGTTCTTTACGGGAGGAAGAGTACGT
TTAAAAGCTCCAATCTGCGTTTGACACTAAACAACACCAG
AGAACAGAAGGACGTGCAAAATTGGATATATTGTGGATTA
TTTTTTTGTTCGGTTGGAAGATCGGGACTTTACGGACTGA
ACTCATGGATGGATGAGAGAAGCTCCCCTGCTGATTTAAG
AGAGAGAGGAGATTACAGCTGAGCTTCACACTGAAGGCTT
TGCTGCTGGAGCTGCAAGAGCCATGAATAGGACACTAACA
GATCCTATGGTCAGTAGCTTCAGAGAAGATGACCCACGTC
CACCGGTCCCAGGGGAAGAGGGTGAGACGACATGCCACCA
TCCCAGCAAACTGGCCATGATGAGACCGAAGGATCCTGTC
AAGACCATTATGGCTGATCTTCGTTGTTCCACGGCCAGGA
GGGATGAGGATGGACTTGGGGAACCTGAGGGCAGCGCATC
CCCGGACTCCCCTCTTGCCCGGTGGACCAAATCTTTGCAT
TTTCTTCTCGGGGACCAGGATGGTGCTCAACTTTTCCGGG
CATACCTTGAACGCGAGAAATGTGTGGACACTTTAGATTT
TTGGTTTGCCTGCAATGGTTTCAGACAAATGGACCTCAAG
GATACCAAAACGCACAGAGTTGCCAAAGCCATTTACAAGC
GGTATATTGAGAACAACAGCATTGTGGCCAAGCAGCTTAA
ACCTGCCACTAAGACCTTTATTAGGGATAATATTAAGCGT
CAGCAGATTGACTCTGCAATGTTTGATCAGGCTCAAATGG
AGATCCAGACGGCTATGGAGGAGAATGCCTATCAGATGTT
TTTGACCTCGGACATATACCTCGAGTATGTCAGAACTGGG
TGCGAGAACCCCAGTCATGTGAATCCCAATGGTCTAGGAG
GTCTAAAGCTGGTGTGCGGATACTTGCCAACTTTAAATGA
AGAAGAAGAGTGGAGTTGTAATGACTTTAAAGCCAAAGCT
TTGGCCACTGTAGTGGGTCTGTCTGCCAAAACACTACGGT
CACCACCTCTTCGTGCTGTGGAAGCACTGGAGAAAGGCTA
CAGGTCCTACAGACGCAGTGACCCCGGAAATCCTAATCGT
TTTACGTCCGGTTATAGTTTTGCCCCTGCCACGAGTGCCA
ATGACAGTGAAGTTTCTAGTGATGCACTGACGGATGACTC
CATGTCAATGACAGACAGTAGTGTAGATGCCATTCCTCCT
TACAAGCTGGGAAGTAAAAAACAATTACAACGAGAGATGC
AGCGCAACATGAGGATGAACGGCCAAGTGTCTCTGCCTCC
GTTCCCTAGGACGCGGCGGCCACCTAAGGAGATGACTCCC
GTGGAGCCAGCAGCCTTTGCAGCACAGTTGATAGCCAGAC
TGGAGCGACTGAAGCGGGAACAGGAAACCATGAGCTCCCT
GGAGGAGAGACTTCAACAGATTCAGGAGGAGGAAGAGCGA
GATGAATCTGAGATGTCTAGTAGCAGTGCGTCCCATTCTC
TGCCTTTGCTCCCTCCTGGCACTTGTGAGGAGGATCCTCA
GGCCATCCTGGACGAGCACCTTTCCAGAGTCCTCAAGACC
CCTGGCTGTCAGTCTCCAGGATTGCTTCGACATTCCCCAC
GCTCTCGCTCTCCTGAACAGCGTCCCCTGCCTCGGGGAGG
TCTCAGCACAAGGTCACAGTCTAGCTCTATGAATGGATAT
GTGCCAGCCAAGACCTTCATTTCTAGACAGTCAACCAAGC
ACATCCATCACCACTACATCCATCACCATGCTGGGCCTAA
AAGCAAGGAGCAGATTGAGGTGGAGGCGACACAGCGGGTA
CAGTGCCTGTGCCATGGAACCTCAGAATGCTGCACTGCTC
CTTACATTCGCAGCCGGAGTCTGGGCAGAGACCAGTGTGC
CAGCCCTGCAGAAGTGGCCTTGGGGCATTCCAGTACTTTA
TCCAAGCGTCTGTGTAAATCTGGAGAGGAGGTGAACATGG
AAGGGCTGGAGAACAGTCTCCTCCAGCTGCCAGCTGACAG
TACAGATCGCTCTCAAAATGTATGGCAATGGATCCTGGAG
AGCGACCGACAAACCAAGCACAAGCCCCACAGCACTCAAA
ATGTAAAGAAGTCGCACAGTTTGGAACCAACGCGCACGCA
CACCTGGGGAGGTGGCGGAAGCAGTGGGCATCTCCGTGCC
CACCAGCCCGCACACCCCTTTGTTCAGGACCCCGCCATGC
CACCTCTACCCCCTCCCAACACCTTAGCACAGCTTGAAGA
AGCCCGCAGACGCCTGGAGGAAGTTTCCAAACCCTCAAAA
CAAAGGCATTCAACATCAAGCCTTCAGAGAGACAAGAGTC
ACCCAGTGCCTGTTCAGAATGGCAGTTCAGCATTTCCAAT
GGACGAAAGGAAAGATCCTAAGAAGATGTCAGGCTGTCAC
AGTAGTTTGGGCTCGGAGACGGTAGTCACGTACTTCTTTT
GTGGTGAGGAAATCCCATATCGGCGGATGATGAAAACACA
CAGCCTTACCCTCGGACACTTCAAGGAACAACTACGGAAA
AAAGGCAACTACAGATACTTCTTCAAAAGGGCCAGTGATG
AGTTTGAGTGTGGTGCTGTGTTCGAGGAGGTCTGGGATGA
CTGCACAGTTCTGCCAATGTATGAGGGCAAAATCCTCGGC
AAAGTGGACAGAATGGACTAAAAGGACACGTGGAATTACC
CAGCACTCGAAACTAACTCAAGGAGCTAGAGCTTCATAAC
TCAAAACGGATGTCCAATGAAGACGTTTGGCTTACAAGCT
ATTGAAGGAATACTGGCCAATGAAGTACAGAGGGATCTGA
ACCAGCGGGAAAACTACGACGAGAGATGTTCTAACCAATG
AAGACTCGGTCAACTATTCGCTTATTCGGACTACAATTCG
CCAACTTTGCTGTGTTACCAGAACGTGGACTGCTGACCAG
CATTCGTGATGATAATTGTAGATGTGTGTACATGTGTTGG
ATGCAAGAACGTGTGCATGTGTATACAGAGGTGCTCCTAT
GTACACAGTTATAATATGCTTCTATCACAAGTTAAAGACT
TTATTACTATTTATTAAACTGTCATTCCCCTCATACCTGT
GTTCAGATGATGGACAAGCTGCTTATTTTATTGGGAGATT
TTTTTCCAATGTCGACTCAACAGACTGTACCAGGAACCTT
CTCTTCTGACCAATGAGAACAAACTGTGCTTTAGACCAGC
ACGCCTCTGCAAGCCTCTCAGCTGATATGGTGGATATTTC
AACCTTTATCCCCCAGCCAATAGCCGATGATGTGTTGCAT
CTTTAGTGCCTTTGGTTTAAGGTCCAGACATTGCACAGGA
ACCAGTAGCCTTGTCCTGGAGCCTACTCCAAAACTATTTA
AATGAACAATAGTAATAAAAAGACACACTATTTAA

axin2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA axin2-002 (1) 1429
mRNA axin2-202 3515
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
axin2-202 Contained in:
OTHER axin2-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025343 (1)
  • Ensembl_Trans:ENSDART00000162413 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AB032263 (1) 3485bp
    GenBank:AJ854187 (1) 3416bp
    GenBank:AF387812 (1) 3411bp
    GenBank:BF156229 (1) 640bp
    CITATIONS (2)