header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8014
Transcript Name: mmp9-201
Previous Name: mmp9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025258 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025258|OTTDARG00000020255|ZDB-GENE-040426-2132 mmp9|OTTDARP00000020784 mmp9-001 LG_ CR391966.8 Danio rerio protein_coding KNOWN, 2785 bp
GACACAGCAACACTGCTTCCACTTCATCTGATCTGATCTG
AGCACTTGCAAGACAGTTTCTCCAGATTTCTTCTGAATTT
ACTTTTATATTTGCGACTCAAAATGAGACTTGGAGTCCTG
GCGTTTCTGGTTCTGGGCACCTGCTCGTTGAGAGCCTGGT
GTTTGCCACTCAAATCTGTGTTCGTGACGTTTCCTGGAGA
TGTGATCAAGAACATGACCAACACACAGCTAGCGGATGAG
TATCTGAAGCGTTACGGCTACATCGATGTCCTCCAGAGGA
GCGGACTGCAGGCGGTCGTCTCCAATACTAAAGCTCTGAA
GAAGCTCCAGCGGCAGCTCGGTTTGGAGGAGACCGGCTTG
CTTGACCAGCCCACCGTTGATGCCATGAAGCAGCCCCGCT
GTGGCGTGCCGGACATCCGCAACTACAAGACATTCGACGG
AGACCTGAAGTGGGATCACACAGATGTCACATACAGGATT
TTGAACTATTCGCCAGACATGGAAGCCTCTTTGATCGATG
ATGCTTTTGCCAGAGCTTTTAAAGTTTGGAGTGACGTCAC
CCCTCTGACGTTCACACGCCTCTTTGACGGCATTGCTGAC
ATCATGATCTCTTTCGGGAAAGCAGATCACGGTGATCCCT
ACCCCTTTGATGGAAAAGATGGGCTGCTGGCTCACGCTTA
TCCTCCAGGTGAAGGCACACAGGGAGACGCTCATTTTGAT
GACGATGAATACTGGACCCTTGGCTCTGGACCAGCCATTC
AAACCCGCTACGGTAATGCTGAGGGTGCAATGTGTCACTT
CCCCTTCCTGTTTGAGGGAACATCCTACTCCACCTGCACC
ACTGAGGGCCGCACAGATGGCCTTCCCTGGTGCTCAACCA
CCGCAGACTATGACAAGGACAAGAAGTTTGGCTTCTGTCC
CAGTGAGCTTCTCTTCACATTTGACGGGAACAGCAATGAA
GCACCATGTGTTTTCCCCTTCATTTTTGATGGGAAGAAAT
ATGATTCATGCACTACAGAAGGACGAAATGACGGATATCG
CTGGTGCTCCACTACAGCTAACTTTGACACTGATAAGAAG
TATGGATTCTGCCCTAACAGAGATACGGCTGTGATTGGTG
GAAACTCAGAAGGAGAGCCATGCCATTTTCCATTCACCTT
CCTGGGAAACACATACTCATCCTGCACCAGTGAGGGCCGC
AATGATGGAAAACTCTGGTGTGGAACTACCAGCAACTATG
ATACTGATAAAAAATGGGGATTTTGCCCTGATCGTGGATA
CAGTCTGTTTCTGGTGGCTGCTCATGAGTTTGGACATGCT
CTTGGTTTGGATCACTCCAACATTAAAGATGCCCTGATGT
ATCCCATGTACAAATACGTGGAGGGTTTCCCCCTGCATCG
TGACGATATTGATGGCATTCAGTATCTCTATGGACCTAGA
ACTGGCCCTGAACCCACTGCTCCTCAACCACGGACCACCA
CTTCCTCTCCAGTTGTGCCAACGAAACCTTCTCCAAGTGA
CAAAACAACCACTGCTTCCACCACAACTCAGGTGGTCCCT
TCAGACGATGCCTGCCAAATCAAGGAGTTTGACGCCATCA
CTGAAATCCAGAAGGAGCTTCACTTCTTCAAGGACGGGCG
CTACTGGAAGATCTCAGGCAATGGTGAACGCAAAGGTCCT
TTCATGATCTCTGCGAAGTGGCCTGCTCTCCCAGCTGTCA
TCAACTCTGCCTTTGAGGACCACCTCACCAAAAAGATCTA
CTTCTTCTCAGAGAGACAGTTCTGGGTTTACAGTGGAAAT
GATGTGCTTGGACCACGTAAAATCGAGAAGCTCGGCCTAC
CAAGCGACTTGGACAAAGTGGAAGGATCTATGCAGAGAGG
AAAAGGCAAGGTGCTCCTGTTTAATGGAGAAAACTTCTGG
AGACTTGATGTAAAGGCTCAGCTGATTGACAGAGGATACC
CTCGATTCACTGATGCAGCTTTCGGTGGAGTGCCCGTTGA
TTCACATGATGTATTCCTCTACAAGGGATTCTTCTACTTC
TGCCGGGAGAGCTTCTACTGGAGAATGAATGCCAAACGGC
AGGTTGACCGAGTCGGTTATGTGAAGTACGACCTCCTGAA
ATGCAGTGACATTCATTCTCTATAGACCTTCGACATCCTA
ATCTGATGACAGAGCCCTTTTTTAACAGGGAAACCGTTTC
TCTTCAGTGTAAAATGTAGCGAGGAAGACACAGACAGAAT
GTATTAAATTTCAAGTGTCTGTTAAAGGGATTTTGACTTT
AACTGTTATAGGAAAAGAACAGTTTTAACACTGAAATTAT
CATAGGCACATGAGACGGGATGTTAGGCATATTTGTCCGT
CAGCTTTACCATGGTCTTATAATTTATTATTTCAGCTTCC
CACATAACTGCTTTGGTCATGATGGGTTTCCTAATGGCAC
ATTATTGTAGAAAACGAGGCAAAGCCCGTTTGACTTTAGG
AATTAACTTTGTGCTTGTAAATGTGTGAGTGGAGTCTCCG
CAGGAATGTTGTAGCCGATTTGTTGTGAACAAAGCACCCG
TATTCTGCATTGACCCCATTCAGATGTTTTTGAATGCAAA
GGTTTATTTTTAGCCTTAGAGCTAATGATGGGGATTGCAG
ATTTTGCCATATTGTGAAATCATTTGCCTGGTGTAAATGA
TATTATTAATATTATTAATTTAATGTTCAACCTTCCACTT
ATTTATATTTTTATGTTTGTTGCAGTGTTTGTTTACTTAA
TAAATTTGTAAACAAGATCCTTTAA

mmp9 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA mmp9-002 (1) 583
mRNA mmp9-201 2785
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mmp9-201 Contained in:
OTHER mmp9-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025258 (1)
  • Ensembl_Trans:ENSDART00000062845 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY151254 (1) 2801bp
    GenBank:BC053292 (1) 2790bp
    GenBank:AI384291 (1) 406bp
    GenBank:AW421150 (1) 405bp
    GenBank:CD602384 (1) 340bp
    CITATIONS (2)