header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8015
Transcript Name: mmp9-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025259 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025259|OTTDARG00000020255|ZDB-GENE-040426-2132 mmp9|no_translation mmp9-002 LG_ CR391966.8 Danio rerio protein_coding KNOWN, 583 bp
ATGCTTTTGCCAGAGCTTTTAAAGTTTGGAGTGACGTCAC
CCCTCTGACGTTCACACGCCTCTTTGACGGCATTGCTGAC
ATCATGATCTCTTTCGGGAAAGCAGATCACGGTGATCCCT
ACCCCTTTGATGGAAAAGATGGGCTGCTGGCTCACGCTTA
TCCTCCAGGTGAAGGCACACAGGGAGACGCTCATTTTGAT
GACGATGAATACTGGACCCTTGGCTCTGGACCAGGTGAGT
GTCGTTTTAACTCAAGTAGCTTTGATAAATAGGTTAAGTG
GTTTAAAACATAATTTAGCATCGCTCTTTATTATAACAAC
TGCATAGTGTGCATAGAGGAGCAATAGCTCCCTCTGCAGT
TCTGAATGAGTAGTGACGGTTACAAACTTTTTTCTTTCAA
AATTGTAATTAAAACAATGATTATTATATATATTTATTTT
AAAGTAAAATACTATTTAAGATTTCTTTTTTAATCTTCCA
TGTTTATTCTTATTGTTTGTGTTTATTAGCAACTTCTGAG
TAAAAATATTTCTTCACCATTTTGTTTTTCAATTTGAGAT
AGCATTTTAACATGTCCTTTGCA

mmp9 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA mmp9-002 583
mRNA mmp9-201 (1) 2785
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mmp9-002 Contained in:
OTHER mmp9-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025259 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DN896724 (1) 596bp
    CITATIONS (1)