ZFIN ID: ZDB-TSCRIPT-090929-7851
Transcript Name: fnbp1l-201
Previous Name: fnbp1l-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025075 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025075|OTTDARG00000020148|ZDB-GENE-040801-155 fnbp1l|OTTDARP00000020645 fnbp1l-001 LG_ CR381644.8 Danio rerio protein_coding KNOWN, 2085 bp
ACATCCCTCCATTTCCCCGCGGCAGAGGCGCATTGTGTGT
GTCGGAAATGGGAAAACCCTGAGCCGTGAGGTTGTCGCTG
CTGGCTTCACTGGAGACTATAGAGAGTTACACGACGGCAG
AGAGAGGGAAGAACAAGCAACCCTGGAGTTTTAAGCGGAG
GAGACGTTAGTTCTTGGAGTTTTTTTTCGCCATGAGCTGG
GGAACGGATCTTTGGGACCAGTTCGAGAATCTCGACAAAC
ACACACAGTGGGGCATCGACTTCCTAGAGCGCTATGCAAA
GTTTGTCAAGGAGCGTCTGGAGATCGAGCAGGCCTATGCA
AAGCAGCTACGGAGTTTGGTTAAGAAGTATTGCCCAAAGC
GCTCCAAAGACGATGAGCCCAGGTTCACGTCTTGTCTGTC
ATTCTACGCCATCCTGAATGAGCTGAATGACTATGCTGGT
CAGCGAGAGGTTGTTGCAGAGGAGATGGGCCACAAAGTGT
ATGGAGAGCTCATGAGATACTCACAAGACCTGAAGGGAGA
GAGGAAACATCATCTTCAGGAGGGACGGAAGGCCCAGCAG
TATCTAGACCAGTGCTGGAAACACATGGACAATAGTAAAA
AGAAGTTTGAACGGGAATGCAAAGAGGCGGAGAAATCGCA
GATGATGTACGAGAGGTTAGACAATGACATCAACGCCACA
AAGTCAGAAGTCGAAAAGGCAAAGTCCCAGCTGTATCTGA
GACAACACATGGCGGAGGAGAGCAAGAACGAGTACGCGGC
CCAGTTGCAGAACTTTAATGGTGAACAGTGGAAACATTTC
AACCAGGCCATCCCTCAGATATTCACTAATCTTCAGAACA
TGGATGAACGGCGAACTGTGAAACTCGGTGAGATGTACCG
GAGTTTTGCTGAGGTTGAGCGAAGAGTCATTCCAATTGTC
TCAAAATGCCTGGAAGGCATGGTTACTGCTGCTAAAAATG
TGGACGAGCGAAGGGATTCTGGGATTGTAGTGGAGTCATT
CAAGTCGGGTTTTGAACCCCCTGGTGATTTCCCTTTTGAA
GACTTCAGTCAGAACATCCAGCGAACAGGGTCAGACAGCA
CCATTGGGACCCCCAAAACAGAGGGAGGCAAACCAGACCC
CAAACACGCAATCAGCAGGACCAAAAACAAACTCTGGCTC
TTTGGAAAGAAACCCAAGGCGCCAACACTAGAGGATCTCA
GCCACCTTCCCCCTGAACAGAGACGCAAAAAACTACAACA
GCGGATCGATGAGCTGAATAAAGAACTGCAGAAGGAACAG
GACCAAAGAGATGCTCTCAACAAAATGAAAGATGTCTATG
AGAAGAATCCCCAGATGGGAGATCCTGGAAGTCTCCAGCC
CAAGATATCAGAGACCATATGCAACATGGAGAAACTCCGC
TCCGAGATCCATAAAAATGAGAGCTGGTTAGCAGAGGTGG
AAGGAAAGCATGGATCTCGAAGTGAGCGGCGGTCCAGTGC
AGATGTAAACCATCACGCTCCGCACGGAAGAGAGAGTCCT
GAAGGCAGTTATACAGATGATCACAGTCAGGAGCATCGGT
CTCCGCCACAGCCGGACCCTCACGAATTTGATGACGAGTT
TGATGATGACGATCCACTCCCTGCCATCGGCCACTGCAAA
GCTCTCTACTCTTTTGATGGATCTAATGAAGGCACATTAG
TGATGAACGAGAACGAGGTGTTATACGTCATAGAGGAGGA
TAAAGGAGATGGCTGGACACGGGTTCGGAAAAATAGCGGA
GAGGAGGGTTACGTCCCCACATCCTACGTGGAGATCACAA
TGGAGAAAAACAGCAAAGGTGCGGTCACCTACATATGACA
TCACCTATGCCTGCCATGACATCACACATGAGGAGCGTGT
GTCAGATTTACCGTGACTCATCAAGCGCAGCTCGGCTGAC
TGCCATATGATTTTGTTCACTGTGTGAGCTCAAGGACAAA
CACACACACACACACACACACACTGTCTGAAGTGACTTTA
CCCTCTCTGCACTGCGGCACAGTGGATCAATCTGTAGAAC
TGTAGAGATTTTTATGAGCTTTTTTAATAAATGTTTTTAA
TCATT

fnbp1l TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA fnbp1l-201 2085
ncRNA fnbp1l-002 (1) 820
fnbp1l-003 (1) 370
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fnbp1l-201 Contained in:
[BAC] CH211-80A15 (1)

Genome Resources: Vega_Trans:OTTDART00000025075 (1),  Ensembl_Trans:ENSDART00000045038 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC077109 (1) 2115 bp
CITATIONS (2)