header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16088
Transcript Name: fnbp1l-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035468 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035468|OTTDARG00000020148|ZDB-GENE-040801-155 fnbp1l|no_translation fnbp1l-003 LG_ CR381644.8 Danio rerio protein_coding KNOWN, 370 bp
CTAATGAAGGCACATTAGTGATGAACGAGAACGAGGTGTT
ATACGTCATAGAGGAGGATAAAGGAGATGGCTGGACACGG
GTTCGGAAAAATAGCGGAGAGGAGGGTTACGTCCCCACAT
CCTACGTGGAGATCACAATGGAGAAAAACAGCAAAGGTTC
CTGATTGGATGATTGGGGTTCTGTGGTGTTTGGTGGACGG
GGCTCACTGCTGTGGGTCTGTTAGTGGGGCGGTGGGGCGA
ATTTAGGAGCGAGATCGTGTTGGGGCAGGTTGCATGTTTG
CATGCTGTTTGTGTCATGGCCATTAACATCATTCCATTGC
AGCAGATGTTCCAGGGATATGCATGGAGGGCATGGGAGAA
CGAGGAAAGA

fnbp1l TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA fnbp1l-201 (1)    Ensembl 2085
ncRNA fnbp1l-002 (1) 820
fnbp1l-003 370
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fnbp1l-003 Contained in:

Genome Resources: Vega_Trans:OTTDART00000035468 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CT663574 (1) 674 bp
CITATIONS (1)