header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7852
Transcript Name: fnbp1l-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025076 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025076|OTTDARG00000020148|ZDB-GENE-040801-155 fnbp1l|no_translation fnbp1l-002 LG_ CR381644.8 Danio rerio protein_coding KNOWN, 820 bp
ACAATAAGTCAAGTTTCAGCGTAGGCCTGCCATTCTGTGG
CTAAAATCATCAGCCAAAAGACATTCACTTGACTGGTGTT
GATGAGCGATTTGTTGTCTTTGTTCTTGCTGAATTGGCGT
GACCTAACCTTAACCTCTCAGTGGTCTTTAAAGCTGGCGC
CAACACTAGAGGATCTCAGCCACCTTCCCCCTGAACAGAG
ACGCAAAAAACTACAACAGCGGATCGATGAGCTGAATAAA
GAACTGCAGAAGGAACAGGACCAAAGAGATGCTCTCAACA
AAATGAAAGATGTCTATGAGAAGAATCCCCAGATGGGAGA
TCCTGGAAGTCTCCAGCCCAAGATATCAGAGACCATATGC
AACATGGAGAAACTCCGCTCCGAGATCCATAAAAATGAGA
GCTGGTTAGCAGAGGTGGAAGGAAAGCATGGATCTCGAAG
TGAGCGGCGGTCCAGTGCAGATGTAAACCATCACGCTCCG
CACGGAAGAGAGAGTCCTGAAGGCAGTTATACAGATGATC
ACAGTCAGGAGCATCGGTCTCCGCCACAGCCGGACCCTCA
CGAATTTGATGACGAGTTTGATGATGACGATCCACTCCCT
GCCATCGGCCACTGCAAAGCTCTCTACTCTTTTGATGGAT
CTAATGAAGGCACATTAGTGATGAACGAGAACGAGGTGTT
ATACGTCATAGAGGAGGATAAAGGAGATGGCTGGACACGG
GTTCGGAAAAATAGCGGAGAGGAGGGTTACGTCCCCACAT
CCTACGTGGAGATCACAATGGAGAAAAACAGCAAAGGTGC
GGTCACCTACATATGACATC

fnbp1l TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA fnbp1l-201 (1)    Ensembl 2085
ncRNA fnbp1l-002 820
fnbp1l-003 (1) 370
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fnbp1l-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000025076 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CN509582 (1) 822 bp
CITATIONS (1)