header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7817
Transcript Name: kat8-201
Previous Names: kat8-001, myst1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025041 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025041|OTTDARG00000020129|ZDB-GENE-030131-7510 kat8|OTTDARP00000020620 myst1-001 LG_ BX571714.7 Danio rerio protein_coding KNOWN, 1713 bp
AACGCGGTGCGCAATGTGTTTTCAAATGGACAAAGATGTC
TGGCGCAGCTATGTCAATGTCCAACAGTCGACACCCGAAC
ATGAACAATTCATATGAGAACTGCGGTTCAGAAGAGCGAA
TGGATGTTGAAATAGACTCTGGTCACGCTGGAACGGACCG
AGGAAGATTGGAAACGGGAACTCGAGCAACATGTTCATCA
AATGGCAGCGGCGGGGAAGAGGATGAGATGGAGGCCGCGG
ATCGAGAACGAGAAGCCACGGGCTCGAGTACTCCGCGCTC
CGCTGACGGAGTGTCGCTTGGCGGCGGCAGAGAGCAGGAG
GTGTCGGTAGAGATTGGGGAGACTTATCTGTGTCAGCGCA
CGGACAAAACATGGCATTCAGCAGAGGTTATTCAGTCCAG
ACTGAATGAGCAGGAGGGCAGAGAAGAGTTTTATGTCCAC
TATGTTGGATTCAATAGACGTTTAGATGAGTGGGTTGGAA
AGGCTCGTTTGGCGTTGACAAAGACTGTGAAAGATGCTGT
GAGGAAGAGTGTGGAGGAAGGGGGTGGAGGAGAACTTGTG
GACCAGCCAGAGAGGAAGATAACACGAAATCAGAAGAGGA
AACATGATGAGATCAACCACGTTCAGAAGACTTATGCAGA
GATGGACCCCACTACAGCAGCCTTGGAGAAAGAGCATGAG
GCGATCACAAAAGTAAAATATGTGGACAAAATCCAAATTG
GGAACTTTGAGATTGATGCGTGGTACTTTTCTCCATTCCC
GGAGGACTATGGAAAACAGCCCAAGCTTTGGATCTGTGAA
TACTGCCTGAAGTATATGAAGTATGAGAAGACCTTCAGAT
ACCATCTGTCACAGTGTCAGTGGCGCCAGCCTCCAGGCAA
AGAGATTTATCGCAAAAATAATATCTCTGTATATGAGGTT
GATGGGAAGGACCATAAGATCTACTGTCAGAATCTGTGCC
TCCTGGCAAAGCTGTTTCTGGATCACAAAACACTTTACTT
TGATGTTGAACCATTCATCTTCTACATCCTCACTGAAGTC
AACAAACAGGGAGCGCATATTGTGGGTTACTTCTCCAAGG
AAAAAGAGTCTCCTGATGGGAACAATGTTGCTTGTATTCT
CACCCTTCCTCCATATCAACGACGAGGATATGGAAAATTT
CTAATTGCATTCAGTTATGAGTTATCTAAGCTGGAAAGCA
CAGTGGGCTCTCCAGAGAAGCCTCTGTCAGACTTGGGAAA
GTTGAGTTATAGGAGTTACTGGTCATGGGTACTACTAGAG
ATTTTGCGGGACTTCAGAGGGACACTTTCCATCAAAGATC
TCAGTCAGATGACGAGCATCACTCAGAGTGACATCATCAG
CACACTACAGTCTCTGAACATGGTCAAGTACTGGAAAGGT
CAGCATGTCATCTGTGTCACTCCCAAACTCGTAGAGGAAC
ATCTGAAAAGTGCCCAGTATAAGAAACCTCCAATAACAGT
GGACACACATTGTTTGAAATGGGCACCTCCAAAACACAAG
CAGGCCAAGTTCTCCAAAAAATGAGGAGTATGAACGGTAA
AGAGGAGAGTACGACTGCCACTTCACCCCTGATGTTTTTC
ACACCTAAATGTCATGTAGAAATACTTTCTCCAAGAGGAA
AATGTCTACGATTGTACATTCGCATTGTATTGAGTCTGTT
ATTTTTTTATAAATAAATGAATAGTAATATTCA

kat8 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA kat8-201 1713
ncRNA kat8-002 (1)    Ensembl 589
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kat8-201 Contained in:
[BAC] DKEY-16L2 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000025041 (1),  Ensembl_Trans:ENSDART00000140290 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC055629 (1) 1686 bp
GenBank:CK689895 (1) 527 bp
CITATIONS (2)