header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14115
Transcript Name: kat8-002
Previous Name: myst1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032865 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032865|OTTDARG00000020129|ZDB-GENE-030131-7510 kat8|no_translation myst1-002 LG_ BX571714.7 Danio rerio protein_coding KNOWN, 589 bp
GGAAAATTTCTAATTGCATTCAGTTATGAGTTATCTAAGC
TGGAAAGCACAGTGGGCTCTCCAGAGAAGCCTCTGTCAGA
CTTGGGAAAGTTGAGTTATAGGAGTTACTGGTCATGGGTA
CTACTAGAGATTTTGCGGGACTTCAGAGGGACACTTTCCA
TCAAAGATCTCAGGTACACATCCAGTCTGAATTTACAAGC
ACAAGGTCACATGTGCTCAAGTATAATTGGATACCTCATA
GGTCTCAAACTCAATTCCTGGAGGACTGCAGATTTTCTCC
AACCCTGGTCAAATAGAGCTGATTCAACTAATGAACGTGT
TCATGACTCTTTTGAACACCTTCATTATTTGGATCAGCTG
TTTGATAGGATTGGAGCAAAACTGTGCAGAGCATCGGCCC
TCCAGAAACAGGGTATATGCGGAGCTAGTGTTTCTTACCA
TATTAATAAACTTTCCGTGAAAGGTTAATGTGACTTTTTT
TTTCCATTTTATACGGTTCCTTTTACAGTATTGAAGTTGT
AATGTAATTACAATACATTCAGTTAAATAGACTTTGACAT
TCATTTAGTTGCTCAGGTGTAAAACAAGA

kat8 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA kat8-201 (1)    Ensembl 1713
ncRNA kat8-002 589
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kat8-002 Contained in:
[BAC] DKEY-16L2 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000032865 (1),  Ensembl_Trans:ENSDART00000143539 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AW202802 (1) 595 bp
CITATIONS (2)