header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7723
Transcript Name: mecp2-201
Previous Name: mecp2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024942 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024942|OTTDARG00000020060|ZDB-GENE-030131-7190 mecp2|OTTDARP00000020540 mecp2-001 LG_none BX571687.17,CR352304.6 Danio rerio protein_coding KNOWN, 1684 bp
TTATTTAAATAAAAATGGCCGCCGCAGAGAGCGGAGAGGA
GAGACTAGGTGAGGACAAGAATGAAGACCAGGAGGGCTCA
AAAGACAAGACGCAGAAGCATAAGAAAAGCAAAAAGGAAA
GGCATGATGTGGAAAAACTGGAGACCACAGTCTCTGTTCC
TCCGCCCCCGTCTCTCTTTACGCAGAGGGATGTCGGACAG
CAGGCAGAGGCAGGGAAGTCTGAACCCATTGACCCTGAAG
TTGGAGCTGCTCTCAGCGCTCCAGAATCTTCCGCATCGGC
CAAGCAGCGGCGGTCTGTCATTCGGGACAGAGGCCCAATG
TATGAAGATCCTTCGCTGCCTCAGGGCTGGACACGCAAGC
TGAAACAGCGCAAATCAGGGCGCTCCGCTGGCAAATTTGA
CGTCTACCTTATCAACCCAGAAGGGAAAGCCTTCCGTTCC
AAGGTGGAGCTCATGGCATACTTCCAAAAGGTTGGCGATA
CCATTACAGATCCCAATGACTTTGACTTCACGGTCACGGG
CAGGGGAAGCCCGTCTCGCAGAGAAAAAAGACCGCCAAAA
AAGCCTAAAATGGTCAAACCCTCTGGACGTGGAAGGGGGC
GGCCTAAAGGTAGCGGCAAGGTACGACAGGCTACAGAAGG
GGTGGCGGTGAAACGCGTCATAGAAAAGAGTCCAGGAAAA
CTCTTAGTAAAGATGCCCTTTGTGGCCCCCAAAACTGAAC
CAGGGGCTCCTTTAGGGCAAGCGCCAGTTGCCAAAGCACG
CCGAGGACGTAAGAGGAAATCAGAGCAGGATCCGCCAAGC
ACCCCTAAAAAACGTGGACGCAAGCCAGCAACTGTTTCAC
AGTCAACAGTGGGGACGGGGTCTGCTGCTGCATACGCCGC
TGCAGCCATTCTCACCGCCGAAGCCAAGAAAAAAGCCCTG
AAGGAGTCTTCCGCTAAGCCTGTTCAGGAGAGGGCTCTTC
CTATCAAAAAACGCAAAACCCGAGAGACTTTAGAGGAGCT
GGAGGCATCCACCACCTCAGCGACAGAGACCTTTGAGAAA
CGACTGACTGCATCAACTGTGACCCCTACCGGGGAGGAGG
CAGAAACAGGACAGAAGCCTCACAAGCATCCCAGCCGGAA
GCACAAAGAGGCAGATCCGGGAAGCAGCAGCAGTGGGACG
ACAGCCAGCGGAGTTGCACCGAAGAGTCACAAGAAGAGAG
ATCAGCGAGGGCAGCACTTTAAACACCACCACCACCATCA
TCATCACCACCATCAACACCAACACCTGCAGGCCTCCACA
CCCTCCACCTACACTCCGCAGGCTCACCAGCTCTCCCTGG
GTCACTCCACGCACGGCGGGCTGGAAAACGAGCCGCAGGA
CTTGAGCACCTCCAGGCCCAAAGCGGAGCACGTGGCCTGC
AGGGAGGAGGCCAGAACTGGCAGCTCCTCGAGTAGGGACT
CCCAGAACGCAAGCAAGATGGCTTCCATGACCGTGACGGG
GGAAAGCAAGGAGCTGAGAGACATTGTTCCTCCCTCCGCC
GTCCCGAGGCCGAGTCGAGAGGAAACGGTGGAGTCCCGGA
CACCAGTGAGCGAGCCAGTGAGCTGACTGACTTAGTGACC
GATCGTCAGAGGGTTTATGCGCAAAGAGGCAGCGAGACGA
GCGATTTTTCGTTCTTTTTTACCGAGGAAAAAAGAAAAAG
AGAA

mecp2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA mecp2-201 1684
mecp2-202 (1) 1673
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mecp2-201 Contained in:

OTHER mecp2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024942 (1)
  • Ensembl_Trans:ENSDART00000040672 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC093116 (1) 1684 bp
    CITATIONS (2)