header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7724
Transcript Name: mecp2-202
Previous Name: mecp2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024943 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024943|OTTDARG00000020060|ZDB-GENE-030131-7190 mecp2|OTTDARP00000020541 mecp2-002 LG_none BX571687.17,CR352304.6 Danio rerio protein_coding KNOWN, 1673 bp
ATGGCCGCCGCAGAGAGCGGAGAGGAGAGACTCAGAGGTG
AGGACAAGAATGAAGACCAGGAGGGCTCAAAAGACAAGAC
GCAGAAGCATAAGAAAAGCAAAAAGGAAAGGCATGATGTG
GAAAAACTGGAGACCACAGTCTCTGTTCCTCCGCCCCCGT
CTCTCTTTACGCAGAGGGATGTCGGACAGCAGGCAGAGGC
AGGGAAGTCTGAACCCATTGACCCTGAAGTTGGAGCTGCT
CTCAGCGCTCCAGAATCTTCCGCATCGGCCAAGCAGCGGC
GGTCTGTCATTCGGGACAGAGGCCCAATGTATGAAGATCC
TTCGCTGCCTCAGGGCTGGACACGCAAGCTGAAACAGCGC
AAATCAGGGCGCTCCGCTGGCAAATTTGACGTCTACCTTA
TCAACCCAGAAGGGAAAGCCTTCCGTTCCAAGGTGGAGCT
CATGGCATACTTCCAAAAGGTTGGCGATACCATTACAGAT
CCCAATGACTTTGACTTCACGGTCACGGGCAGGGGAAGCC
CGTCTCGCAGAGAAAAAAGACCGCCAAAAAAGCCTAAAAT
GGTCAAACCCTCTGGACGTGGAAGGGGGCGGCCTAAAGGT
AGCGGCAAGGTACGACAGGCTACAGAAGGGGTGGCGGTGA
AACGCGTCATAGAAAAGAGTCCAGGAAAACTCTTAGTAAA
GATGCCCTTTGTGGCCCCCAAAACTGAACCAGGGGCTCCT
TTAGGGCAAGCGCCAGTTGCCAAAGCACGCCGAGGACGTA
AGAGGAAATCAGAGCAGGATCCGCCAAGCACCCCTAAAAA
ACGTGGACGCAAGCCAGCAACTGTTTCACAGTCAACAGTG
GGGACGGGGTCTGCTGCTGCATACGCCGCTGCAGCCATTC
TCACCGCCGAAGCCAAGAAAAAAGCCCTGAAGGAGTCTTC
CGCTAAGCCTGTTCAGGAGAGGGCTCTTCCTATCAAAAAA
CGCAAAACCCGAGAGACTTTAGAGGAGCTGGAGGCATCCA
CCACCTCAGCGACAGAGACCTTTGAGAAACGACTGACTGC
ATCAACTGTGACCCCTACCGGGGAGGAGGCAGAAACAGGA
CAGAAGCCTCACAAGCATCCCAGCCGGAAGCACAAAGAGG
CAGATCCGGGAAGCAGCAGCAGTGGGACGACAGCCAGCGG
AGTTGCACCGAAGAGTCACAAGAAGAGAGATCAGCGAGGG
CAGCACTTTAAACACCACCACCACCATCATCATCACCACC
ATCAACACCAACACCTGCAGGCCTCCACACCCTCCACCTA
CACTCCGCAGGCTCACCAGCTCTCCCTGGGTCACTCCACG
CACGGCGGGCTGGAAAACGAGCCGCAGGACTTGAGCACCT
CCAGGCCCAAAGCGGAGCACGTGGCCTGCAGGGAGGAGGC
CAGAACTGGCAGCTCCTCGAGTAGGGACTCCCAGAACGCA
AGCAAGATGGCTTCCATGACCGTGACGGGGGAAAGCAAGG
AGCTGAGAGACATTGTTCCTCCCTCCGCCGTCCCGAGGCC
GAGTCGAGAGGAAACGGTGGAGTCCCGGACACCAGTGAGC
GAGCCAGTGAGCTGACTGACTTAGTGACCGATCGTCAGAG
GGTTTATGCGCAAAGAGGCAGCGAGACGAGCGATTTTTCG
TTCTTTTTTACCGAGGAAAAAAGAAAAAGAGAA

mecp2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA mecp2-201 (1) 1684
mecp2-202 1673
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mecp2-202 Contained in:

OTHER mecp2-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024943 (1)
  • Ensembl_Trans:ENSDART00000123882 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY298900 (1) 1673 bp
    CITATIONS (2)