ZFIN ID: ZDB-TSCRIPT-090929-7460
Transcript Name: fkbp5-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024639 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024639|OTTDARG00000001937|ZDB-GENE-030616-630 fkbp5|no_translation fkbp5-002 LG_ AL732567.8 Danio rerio protein_coding KNOWN, 917 bp
AGACTAAACAGAAGTTGTATACGGACGGATAAATGGTCAA
ACACATGAGAGGAAACAACAACCAAAGGAATATTTTGGGA
ACAAGGGCATGTATGAGTGGTGAGATGTCATCATTAGAGG
ATATCTTTTCCACGAACCAGTGCCCGACTGCTGTCTTTAC
CTCCCGAGGCACTGCTGTCACTCCAAACGGTGACAGTGGA
GTATGCAAGATTGTGAAACAGCATGGTGTAGAGGGGGAAA
GGCCGATGATCGGGGACAGGGTGTTCGTCCACTACACCGG
CAGACTCCTCAGTGGAAAGAAGTTTGACTCCAGTCTAGAC
CGCAAGGAGCCTTTTGTTTTCAATGTGGGGAAAGGTAATA
GATTCCATAGATTTATCTCTCATTTACCAATTTAAGATGT
TATTACTGAAACCATTTTGCAAGAGAGACGTCCAGTGTGA
CGAATGCATAAGCAGACAAATGATTCTGTGTGCTATGTTG
TTATACACATTTTTCTAATTCATTAATCATTATACGGCCA
ACTGTGTGGTGTGCCGTTATTTGGCTCAACTTGTGGACGT
TGGTTTCACATATTTGGTTTTGATGGATTTGCAAAACCTT
ACTTTAATCTGCCAAATCAAATACCCGGTGTAGAAATAAA
TGGAACGGAAATGAGCATACCCTAATAAAATTAGACAGTC
ATCATGTTAACTCTCTTGTGGTTAAATGCTATCTGGCTAA
ATGGTATCTGGCAATACCACAGTAATGGCTTATTGAGTAA
AGCAACATGCATCATATTTTTTTCTGCCTATTAACATCCT
ACGCAAAACTCCACTCTTCACCACATGTGAGAAACGCTGA
TAAATATCAACAGAAAAGAACATTAAACTAAAAAACTTAG
AGTCAATATTTAGCCAGTGCAAAGCTTGCTTGGAACT

fkbp5 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA fkbp5-002 917
mRNA fkbp5-201 (1) 2613
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fkbp5-002 Contained in:
OTHER fkbp5-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024639 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DT076354 (1) 846bp
    GenBank:DN896000 (1) 719bp
    CITATIONS (1)