ZFIN ID: ZDB-TSCRIPT-090929-64
Transcript Name: fkbp5-201
Previous Name: fkbp5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000002068 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000002068|OTTDARG00000001937|ZDB-GENE-030616-630 fkbp5|OTTDARP00000001824 fkbp5-001 LG_ AL732567.8 Danio rerio protein_coding KNOWN, 2613 bp
TATTGGTGTGGAGAAGTGTAAAATACTGCCGGTAGAACAT
CTAGTACTCTCGCGGTGCTGAGAGGGCGGGCTCATTCCCC
TTTAAGCCGCTACGCACAGGTTGTATTCGCCGGTGAGACT
AAACAGAAGTTGTATACGGACGGATAAATGGTCAAACACA
TGAGAGGAAACAACAACCAAAGGAATATTTTGGGAACAAG
GGCATGTATGAGTGGTGAGATGTCATCATTAGAGGATATC
TTTTCCACGAACCAGTGCCCGACTGCTGTCTTTACCTCCC
GAGGCACTGCTGTCACTCCAAACGGTGACAGTGGAGTATG
CAAGATTGTGAAACAGCATGGTGTAGAGGGGGAAAGGCCG
ATGATCGGGGACAGGGTGTTCGTCCACTACACCGGCAGAC
TCCTCAGTGGAAAGAAGTTTGACTCCAGTCTAGACCGCAA
GGAGCCTTTTGTTTTCAATGTGGGGAAAGGTCAGGTCATC
AAGGCGTGGGACATCTGTGTGTGTTCCATGCAGAAAGGAG
AGGTGTGTTTGATGCTCTGCAAGCCTGAATATGCATACGG
TTCTGCTGGCAGCCCCCCAAAAGTCCCTCCTAATTCCACA
CTCGTGTTCGAGATCGAGCTCCTGAACTTCCGAGGGGAGG
AGCTTACAGAAGATGGTGGGATCGTGAGGAGAATAAAGGT
CAAAGGTGAAGGCTACAGCAATCCAAATGAAGGCGCCACT
GTCCACGTGCACTTGGAGGGCTGGTGCGGAGGTCGACTGT
TTGATTCGCGGGATGTCACCTTTGCGGTGGGAGAATCAGA
GGACGTGGGTGTTCCTTTAGGAGTGGACCGAGCCATGGAA
AAACTCCAAAAGGGGGAATGCTGTTTATTATACCTAAAGC
CCAAGTACGCCTTTGGCAAAGAGGGCAGAAAAGAACATGA
CATCGGATCAAATGCAGAACTACTATATGAAGTGACACTG
AAAGACTTTGAAAAGGCCAAAGAAACATGGGAAATGGACC
TCAAAGAGAAACTGGAACGTGCTGTTTTAGTCAAACAAAA
AGGGACACAGTATTTCAAGGCAGGACGATACAACTATGCT
GTAATTCAGTACCAGCGGATCGTAAACTGGTTGGAGATGG
AGTGCGGCAATGGAAAGGAGCAGCTCCAAGCCATCCAGGC
TCTTCTCTTAGTGGCGCATCTGAATCTGGCCCTGTGTTAC
CTGCGGCTGCGCGAATACTCTCAAACAGTGGAGAACTGCA
ACAAGGTAATGGAGCTGGACCCTGAAAATGAGAAAGCTCT
GTATCGGCGGGGCGAAGCGCGTCTGTTACGCAACGAGTTC
AGCCTGGCACTGATGGACTTCAAGCAAGTTTTGCAAGTCA
ACTCCTTCAACCGCGCAGCCCGCAGCCAAATCCTCATCTG
CCAGCACAAGATTCGTGAGCACCATGAGCGGGACAAGAAA
ATCTATGCAAACATGTTCCAGAGGTTTGCTGAACACGATG
CTAAGGTGTGTCGATTGAAACGCAAAAAAGAAGAGAGCGT
TATTTCCGATCAGAATAAGCAGGGTCTAAAGAGAGCTCGG
CTCAGTCAGGACGGCTCCTAAAACTCCTCATCTGACTCTG
GAGGCGCGAGACTGTGGGAATGGCCGGCCCGTTCTCGACT
TGAGTCATGACAGGGGGACATGGGTAGAGGCATGGACGTG
CCCTCCTTTTACACCCTGACCTCATCATCTCTCGGACAAA
CTCTGGGAAAGATCCTAATAAAGGTTCACGGACATGGAGG
AGCTGCAAACCTTAAAGACATTCCTACCAACAACAGAAAA
ACCAAAGCGCACAATTCTGTGACCACCTGTAAAAGCTCTA
TGCTGCACGCTTCAGCTCTCCGACTGGCATTCATCCGCTG
CATTAATCGATGGCGAAAGCTAAAGGTTTAATGTTATATC
GCATAACAGACTTGAATACAGCTGTGTACCCTTATCATGT
ACTGTACAGTATTCAGTCTCCACTTTGTGCAAATTAGGAG
TTCAAGTTTGAGTCGTGTACTGAAGGCTTGACGTTTTATT
ATTATTATTATTATTTTTTTGTATGATATTTTTGTTTAAG
CGATATTTAGATGAGCATAGTGAGTAGCTGGACCTAAAAG
TGCAATCGTCCCTTTGGGGAAAAAACAGAAACTATTTGCG
AATCTCCCAGCTGTGTTTATCATGGAGTCGCAGCAGGCCC
ACGTTCACAAACACACTGCTTTTTATTCATTTGATACTTT
TGAGAGACTTGTGCATGCTTATTTACTGCAAACCTGGGAT
CGTCCTACAATTCGGGACCAGTTAGTTTCAACCTGCAAAC
CCTGGTAGATTTACTTGACTGAAGTTCTATATTTTTTCCA
TTTCAGTGCAGATGCTTTTTAGACAGATCTTTTGATGAGA
TAGGAATATTTCAACTGTTCTTTTCAGACCCGCTTGTTCG
TTTGATCAAATACTAACTAGTGTTGTTTGCATGTTTTCAG
TATGTTTCCCATGTTTTAGACAGTTTTAATAATAATAATA
ATAAAAAAAACTGTTTGTTAACTTTTTCTGTTTACAGTTT
GATGCATTACAGCAGGCCTGTCAATAAATATATATATATA
TATATATAAACTA

fkbp5 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA fkbp5-002 (1) 917
mRNA fkbp5-201 2613
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fkbp5-201 Contained in:
OTHER fkbp5-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000002068 (1)
  • Ensembl_Trans:ENSDART00000028373 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC054610 (1) 2607bp
    GenBank:CO931853 (1) 840bp
    GenBank:DT060884 (1) 817bp
    GenBank:CO248649 (1) 815bp
    GenBank:CF996256 (1) 730bp
    GenBank:AW076792 (1) 715bp
    GenBank:BI706429 (1) 579bp
    GenBank:BG306168 (1) 478bp
    GenBank:AW076537 (1) 462bp
    GenBank:BG307814 (1) 419bp
    GenBank:BG738795 (1) 320bp
    CITATIONS (2)