ZFIN ID: ZDB-TSCRIPT-090929-7449
Transcript Name: c1galt1b-202
Previous Name: c1galt1b-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024626 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024626|OTTDARG00000019887|ZDB-GENE-030131-9075 c1galt1b|OTTDARP00000022946 c1galt1-002 LG_none CR847871.5,CR753817.13 Danio rerio protein_coding KNOWN, 791 bp
TTGTGCAAGCGTTCAGGCGTTCAAGTAGGATTTTCTTTTG
TTTTTTAAATAAAAGCGACTCATCGTTATGAGATGGTCGC
TGTGAGGTGAGGGTCTCTACATACAGAGCTCGTGATGAAG
GCTCTCGGCGCGCGCTCCGCGTTCTACGTGGGCTTTCTGG
TGGGCACGTGCAGCTTATACCTGCTCCTGCGTCAGGCTGG
GTTCACCCGGGACTCGGGGTCTCGTGAGCCCGGGACCCAC
GATAAAACCCTGCTGGAAATGCTTGAAGAAGAAAACAAGA
ACTGGAAGAAGGAGAGGTCGGCTCTTTTCAACCTCAATCA
TCCGCACCATACAGGTGAGGATGGCGCACTGGCTGACTCT
CTTTATAAGCGTGTACGCATTCTCTGTTGGGTTATGACTG
GCCCTGATAACCTGGAAAAGAAAGCTCGGCATGTGAAAGC
CACATGGAGTCGTCACTGCAACATTGTGGTCTTTATAAGC
TCTGTGGACAATCCAGATTTTCCCACAGTTGGCCTGAACA
CTAAAGAAGGTCGGGATCAGCTATACTGGAAAACCATCCG
CGCTTTCCACTATGTCATGGAGAAGCACGGCGATGAGGCC
GACTGGTTTCTCAAAGCAGATGATGACACTTATGTGATCG
TTGACAACCTGCGCTGGATTCTGGCTCGCCATTCTCCAGA
GGACCCAGTGTACTTTGGCCGGCGTTTTAAGCCATATGTA
AAACAGGGCTACATGAGTGGAGGTGCTGGCTATGTGCTCA
GCAAAGAAGCTCTGAGGAGGTTTGTGGAGGG

c1galt1b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA c1galt1b-201 (1) 2016
c1galt1b-202 791
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
c1galt1b-202 Contained in:
OTHER c1galt1b-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024626 (1)
  • Ensembl_Trans:ENSDART00000131793 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DT880812 (1) 787bp
    CITATIONS (2)