header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7448
Transcript Name: c1galt1b-201
Previous Name: c1galt1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024625 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024625|OTTDARG00000019887|ZDB-GENE-030131-9075 c1galt1b|OTTDARP00000022945 c1galt1-001 LG_none CR847871.5,CR753817.13 Danio rerio protein_coding KNOWN, 2016 bp
ACCGCTCGGCTTTAACGTACTTGCTGAACATTCGGATCAG
TTAGGAAGATAGGAAGCACGCTGCTAGTTAGCCTTAAGTA
AAGCATAATATTATCTACCAACCCAAACTTGTATGGGTTA
GAATACAGCCAGGATATGATTCTGGAGTCCGTTCATGTGA
GTAGGCTGTCAAATGTCTTGGATTTCAGTTAAAAACCGTA
GTTCACGATAATGCTAGCTCTCTGAATTGGACCGAAATGG
CCTCGGAGCCGAATCCTGCGGTTTTTCTCACTTCTGTTAT
GGAGGAAATCAACAGCCTGTCGCTGTGAGGTGAGGGTCTC
TACATACAGAGCTCGTGATGAAGGCTCTCGGCGCGCGCTC
CGCGTTCTACGTGGGCTTTCTGGTGGGCACGTGCAGCTTA
TACCTGCTCCTGCGTCAGGCTGGGTTCACCCGGGACTCGG
GGTCTCGTGAGCCCGGGACCCACGATAAAACCCTGCTGGA
AATGCTTGAAGAAGAAAACAAGAACTGGAAGAAGGAGAGG
TCGGCTCTTTTCAACCTCAATCATCCGCACCATACAGGTG
AGGATGGCGCACTGGCTGACTCTCTTTATAAGCGTGTACG
CATTCTCTGTTGGGTTATGACTGGCCCTGATAACCTGGAA
AAGAAAGCTCGGCATGTGAAAGCCACATGGAGTCGTCACT
GCAACATTGTGGTCTTTATAAGCTCTGTGGACAATCCAGA
TTTTCCCACAGTTGGCCTGAACACTAAAGAAGGTCGGGAT
CAGCTATACTGGAAAACCATCCGCGCTTTCCACTATGTCA
TGGAGAAGCACGGCGATGAGGCCGACTGGTTTCTCAAAGC
AGATGATGACACTTATGTGATCGTTGACAACCTGCGCTGG
ATTCTGGCTCGCCATTCTCCAGAGGACCCAGTGTACTTTG
GCCGGCGTTTTAAGCCATATGTAAAACAGGGCTACATGAG
TGGAGGTGCTGGCTATGTGCTCAGCAAAGAAGCTCTGAGG
AGGTTTGTGGAGGGCTTTCGCACCAAGGTGTGCACTCACA
CTACCTCAGTGGAGGACCTTGCTATGGGTCAGTGTATGGA
GAAGATAGGTGTCAAGGCAGGAGACTCCAGAGACACCATG
CAAAGAGAGACATTCCATCCTTTCGTACCCGAGTCCCATC
TTACTGGCACATTTCCCAAAACTTTCTGGTACTGGAACTA
CTGTTATTACCCCATTGTACAGGGCCCACAGTGTTGCTCA
GACCTGGCTGTTTCTTTCCACTATGTGGATGCGTCGCACA
TGTACCTGCTGGAATACTACACTTACCACTTGCGTGCCTT
TGGCTACAAATATCGCTATCAGCCCCCTGAACCCAATGTT
AAAGCCCCAGAGAAAGTAGAAACTCGAGTCTTGGAGCAAA
AGGACAAGGTTGAAGCACAGGAAGAGGAAAACCAATCCCC
TGAACTTAACGACAAGTTATAGCAGCTTATTTTGACAAAA
TGGAAACTTTCCAACTCTTCCACACACACACAAACTATTT
TTGGGGATGTCTTACCCCCCTTTTTTGTTTTTGGATATCG
TCTCCTGTATATGTGCGACAGAAAAGTGTGCACGACTTAT
TTGTTTGATTGAATGCAATTGGTACAGTTTGGGAGGGTTT
TTCCTCTTGATAATGCATTTGTATGTGAATGTTTAAATAT
ATATGACAGTGCTGAATTGTATGATATGAAGGTTGACGTG
TAGTCTATGAGCCTGCCTTAATAGTACAATAACAACAAAC
AATAATGCCTCTGCATTCGTTACACTTGGCGTTCAGTTAT
AACTGTTTATATATAAAATGTGTAATCATAAGCACATATG
CTACTTACTGTATGTAACAACAATGCCATTTGAAGAAGGT
GGCTTTGGTTTTCCTTTCATGTGATCATTCCCTAATTAGT
GCCTCTTTAATTACACACTTCAGTATGTATTTATATTTAG
TTTAGGTCATATTTAAACACTGAGCGGCTTGTACTATGGA
TGTTACATCCTGCAAA

c1galt1b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA c1galt1b-201 2016
c1galt1b-202 (1) 791
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
c1galt1b-201 Contained in:
OTHER c1galt1b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024625 (1)
  • Ensembl_Trans:ENSDART00000077938 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC054714 (1) 1723bp
    GenBank:DV600420 (1) 756bp
    GenBank:CV117268 (1) 731bp
    GenBank:CV117776 (1) 725bp
    GenBank:AW116587 (1) 659bp
    GenBank:AW134265 (1) 578bp
    GenBank:CR930057 (1) 539bp
    GenBank:BG892070 (1) 469bp
    GenBank:BG729284 (1) 433bp
    CITATIONS (2)