ZFIN ID: ZDB-TSCRIPT-090929-7417
Transcript Name: cyfip1-201
Previous Name: cyfip1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024593 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024593|OTTDARG00000019867|ZDB-GENE-030131-8557 cyfip1|OTTDARP00000020289 cyfip1-001 LG_none BX322552.6,FP085470.9 Danio rerio protein_coding KNOWN, 4645 bp
GGAACTTCCAGCCCGAGCTGCGCCTGCGACAACATTCACC
GCGAGCAGGATTCCTCCGCAAACTCCCTCAAACCTCTCCA
AACAGCCGCTCATTACCACCGAAAACACTTTCACCAGTGG
ACTTCACTCTCTCAGCCGCCTCACGACTGGAAACCCCACC
AGAAAATGCATGAATGAACAGTCGAAGCGGATAGTTTTTT
TCCTGGAAAACCCAAGTACGGAGCAATGGCGTCCACAGTG
ACTCTGGAAGATGCTCTGTCCAATGTGGACTTGCTGGAGG
AGCTGCCACTTCCAGATCAGCAGCCCTGCATCGAGCCTCT
GCCCTCCTCACTCATTTACCAGCCCAACTTCAACACCAAC
TTTGAGGACCGCAATGCGTTTGTGACCGGCATCGCCCGTT
ACATCGAACAGGCCACCGTCCACTCCAGCATGAATGACAT
GTTAGAAGAAGGTCAGCAGTATGCTGTGATGCTGTACACG
TGGAGGTGCTGTTCGAGAGCTATTCCTCAGGTGAAGTGTA
ATGAACAACCCAACAGAGTGGAGATCTACGAGAAGACTGT
GGAGGTGCTCGAACCCGAAGTCAACAAACTAATGAACTTC
ATGTACTTTCAGAGGACAGCAATAGATCGCTTTTGTGGTG
AAGTGCGTCGTCTCTGTCATGCAGAGCGGAGGAAAGACTT
TGTGTCTGAAGCTTATCTGCTCACTCTGGGAAAGTTTATC
AACATGTTTGCGGTGCTGGATGAACTTAAGAACATGAAGT
GCAGCGTCAAAAATGACCACTCCGCCTACAAGAGAGCTGC
TCAATTCCTGAGGAAAATGTCAGAGCCGTCATCAATTCAG
GAATCCCAAAACCTATCTATGTTTCTGGCCAACCACAATA
AGATCACTCAGTCCCTGCAGCAGCAGCTTGAAGTGATTAA
CGGATACGATGAGCTGTTGGCAGACATTGTTAACCTGTGT
GTGGATTACTATGAAAACAAGATGTACCTCACCCCTAGTG
AGAAACACATGCTACTCAAAGTAATGGGCTTTGGTCTCTA
TCTCATGGATGGAAGTAACAGCAACATCTACAAACTGGAA
GCTAAGAAGAGAATCAACCTCACAAAGATCGACAAGTTCT
TTAAGCAATTGCAGGTAGTGCCTCTGTTTGGTGACATGCA
GATTGAATTGGCTCGCTATATCAAAACCAGCGCTCACTAC
GAGGAAAACAAGTCTAGGTGGTCATGCACGTCAGCAGGCA
GTAGCCCACAGTACAATGTCTGCGAACAGATGATTCAAAT
CCGGGAGGATCACATGCGCTTCATTTCTGAATTGGCTCGA
TACAGCAACAGTGAGGTGGTGACTGGCTCTGGGCGTCAGG
ACGCTCAGAAGACGGACTCTGAGTACAGGAAGTTGTTTGA
TCTGGCTCTGCAGGGCCTGCAGCTGCTCTCTCAGTGGAGC
GCTCAGATCATGGAAGTGTATTCCTGGAAATTGGTGCATC
CTACAGACAAATACTCCAACAAAGAATGCCCTGACAATGC
TGAAGAGTATGAGCGTGCTACCAGATACAACTACACCAGT
GAGGAGAAATTTGCTCTGGTGGAGGTCCTCGCCATGATAA
AGGGCTTGCAGGTACTGATGGGCCGAATGGAAAGTGTGTT
TAACCACGCCATCCGTCACACCATTTATTCAGCTCTGCAA
GACTTTGCCCAAGTCACGCTCCGTGAACCGCTGCGCCAGG
CCATCAAGAAAAAAAAGAATGTCGTCCAGAGTGTCCTCCA
GGCCATCCGTAAGACCGTCTGTGATTGGGAAACAGGCAGA
GAGCCACATAATGACCCAGCGCTGCGGGGAGAGAAGGACC
CTAAAGGGGGATTTGATATCAAAGTCCCTCGTCGCGCTGT
TGGACCCTCCAGCACTCAACTGTATATGGTCAGAACAATG
CTGGAGTCTCTGGTCGCAGATAAGAGCGGATCAAAGAAGA
CCTTGCGCAGTAGTCTGGAGGGGCCGACCATTCTGGACAT
CGAGAAGTTTCATCGCGAATCCTTTTTCTACACTCATCTG
CTCAACTTCAGTGAGACTCTGCAGCAGTGCTGTGATTTGT
CCCAGCTCTGGTTTCGGGAGTTCTTTCTGGAGCTCACTAT
GGGCCGCCGCATCCAGTTCCCCATTGAGATGTCCATGCCC
TGGATCCTTACCGACCACATCCTGGAGACTAAAGAGGCGT
CTATGATGGAGTACGTGTTATATTCTCTGGATTTGTACAA
CGACAGTGCACACTACGCTCTCACTAAGTTTAAAAAGCAG
TTCCTTTATGATGAGATTGAAGCGGAGGTGAACCTCTGCT
TTGACCAGTTTGTCTACAAACTTGCTGATCAAATATTTGC
CTACTACAAGGTTATTGCCGGAAGTCTTCTTCTGGATAAA
AGACTAAGAGCCGAATGTAAGAACCAGGGTGCAAACATCT
CATGGCCTTCCTCCAATCGTTATGAGACACTCCTGAAACA
GAGACACGTCCAACTCCTTGGACGATCGATTGACTTGAAC
CGCCTGATCACTCAGCGTGTGTCTTCTGCGCTTTACAAAT
CCCTGGAGCTGGCCATCAGCCGCTTCGAGAGCGAGGACCT
CACCTCCATCATGGAGTTGGAAGGTTTGTTGGACATAAAC
CGAATGACCCATAAACTCCTCAGTAAGTATTTGACACTGG
ACAGCATCGACGCCATGTTCCGAGAGGCAAACCACAACGT
TTCCGCACCCTACGGCAGAATCACTCTTCATGTCTTCTGG
GAGTTGAACTATGACTTCTTGCCAAACTACTGTTACAATG
GCTCCACGAACAGGTTTGTTCGCACCATTCTGCCGTTTTC
ACAGGAGTTTCAGAGAGACAAGCCTCCCAACGCTCAGCCA
CAGTACCTGTATGGCTCAAAGGCCTTGAATTTGGCGTACA
GCAGCATATACAGCCTCTACCGCAACTTTGTGGGACCTCC
ACATATTAAGGCTATTTGCAGACTTCTGGGATACCAGGGA
ATCGCTGTGGTGATGGAGGAGCTGTTAAAAGTTGTCAAAA
GCCTGCTTCAAGGCACCATCCTTCAGTATGTGAAGACATT
GATGGAAGTGATGCCCAAGATTTGCCGTCTGCCTCGCCAT
GAGTATGGCTCACCAGGTATCCTGGAGTTCTTCCACCACC
AGCTGAAAGACATTGTGGAGTACGCTGAGCTGAAGACTGT
GTGCTTCCAGAACCTGAGGGAGGTTGGAAACGCATTGCTC
TTCTGCCTTCTGACTGAACAGAGCTTGTCCCAAGAGGAGG
TGTGCGACTTGTTGCACGCAGCTCCCTTCCAGAACATCCT
ACCAAGGGTTCACGTCAAAGAAGGAGAGCGTCTGGATGCA
AAGATGAAGCGTTTGGAGGCCAAATACACAGCGCTGCATC
TGGTGCCTCTGATTGAACGTCTGGGAACCCCTCAGCAAAT
CGCCATCGCCCGTGAGGGAGACCTGCTGACTAAAGAGCGT
CTGTGTTGCGGACTCTCCATATTTGAGGTTATTCTGACAC
GCGTCCGCGCTTACCTGGACGACCCGATCTGGCGTGGGCC
TTTACCCAGCAATGGAGTGATGCATGTAGACGAGTGTGTG
GAGTTTCACCGGCTGTGGAGCGCAATGCAGTTTGTGTACT
GCATCCCTGTGGGCGCACATGAGTTCACTGTTGAGCAATG
TTTCGGAGACGGTCTGAACTGGGCTGGTTGCATGATCATC
ACTTTACTCGGTCAGCACAGACGCTTTGACATCCTGGACT
TCAGCTACCATCTCTTGAAGGTGCAGAAACACGACGGTAA
AGATGAGATCATCAAGAGCGTGCCTCTGAAGAAAATGGTT
GACCGAATTCGCAAATTCCAGATTCTGAACGATGAGATCT
TCGCCATTTTGAACAAGTACCTGAAGTCTGGAGATGGAGA
GAACATGCCAGTAGAACACGTGCGGTGCTTTCAGCCTCCC
ATCCATCAGTCTTTGGCCAGTAACTGAGATTTATTTGTTC
ATTTGCACCAGTTTGAAGTGGAAGAGATGGGAAAAGAGAG
GGAAATATTTAGCAACGTGTTTAGGACCAGTTTCACTGTC
ACATTCTACTTAATGATGCCTTTCTTATGCCACCCTGTAG
TTTCTGCAGAGCCAGTAAGTTGCCTTGTGATTGGTCGAGT
GATTTGATTTGCACCAATTACTGCACCCTACTCAGGCTTT
GGTTAATCAGGCCAAGATATGTTTATGATGTACACAAACA
TGGCTCAGTTTTACTAGCGTATTTCAGGTTGATTTTTTTT
GTACACATAAACACACACATACACACACACTCGTGCCTTA
TTATAGATAAATTGACTATAATCTTTTATATGTTAATGAT
AGCACAGCACTACTCATGTTTTATACTTGGGAACAGCAGT
GGGGAATGGTTCCAAAATGGCCAAGTGGGTTTTATCAAAG
GGTTATTTAAGCTTTTGCTGTAGTGCGAGTCCAGCGGTAT
TTTTTCTATGTGGTGTTGAATGATTGCATGCAAGTTTTTT
TTTCTTCTATTATACTTAATAAAACTTTAAGCGTAGCCAA
GTTCTTACTCCTCATAAACGTGCCTTTTTTGTATTTGAAT
TGTGTAATCAAATTTTAATTCAATAAAAAATGTATCAAAT
TCAGG

cyfip1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA cyfip1-003 (1) 510
cyfip1-004 (1) 515
mRNA cyfip1-201 4645
cyfip1-202 (1) 1654
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyfip1-201 Contained in:
OTHER cyfip1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024593 (1)
  • Ensembl_Trans:ENSDART00000065127 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY017342 (1) 4126bp
    GenBank:BC091781 (1) 1760bp
    GenBank:BC121783 (1) 1731bp
    GenBank:CT687755 (1) 842bp
    GenBank:CK017154 (1) 800bp
    GenBank:DT065670 (1) 779bp
    GenBank:CT613030 (1) 770bp
    GenBank:CT625535 (1) 731bp
    GenBank:CT625536 (1) 681bp
    GenBank:CD596845 (1) 650bp
    GenBank:AW233416 (1) 649bp
    GenBank:CO357260 (1) 600bp
    GenBank:AL923428 (1) 526bp
    GenBank:AL915191 (1) 525bp
    GenBank:CK711941 (1) 508bp
    GenBank:AI331713 (1) 488bp
    GenBank:CB362499 (1) 481bp
    GenBank:CK708190 (1) 413bp
    CITATIONS (2)